Latest adhesive dressings Tenders | Government adhesive dressings Tenders

Corporations And Associations And Others

CTN :39422929

21 Apr, 2025 51.44 Crore

Panchkula - Haryana

Tender For corrigendum : online tender for the rate contract for the supply of dental items to various hospitals of government of haryana for a period of two years for group c - cotton rolls ( small, pkt of 1000 pcs), disposable patient drape sheet 1*1mm, gum paint based on tannic acid, potassium iodide, zinc chloride, glycerine with thymol/ menthol /cetrimide, liquid 15 ml bottle, hybrid composite resin for anteriors (all shades), high strength, long lasting wear resitance, great handling without stick, 4 gm isi/ iso/ce/marked., rubber dam kit adult, box of 152*152 mm, medium rubber dam sheets, 152 mm template, 152 mm plastic dental dam frame, 6-11 clamps pack with clamp holder, rubber dam clamp forcep, rubber dam punch mdr/isi/iso/ce marked, glass ionomer cement- type-ix, high strenth for posterior teeth, chemical setting without shrinkage, strontium based, high flouride releasing, 12 to 15 gm powder and 5 to 10 gm liquid, mdr/isi/iso/ce marked, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel. shade :- pale yellow, shade :- pale yellow, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- yellow brown, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- dark grey, mdr/isi/iso/ce certified /usfda, disposable suction tips pkt of 100, mineral trioxide aggregate mdr/isi/ iso/ce/marked., silver alloy non gamma-2 lathe cut alloy, 30 gm vial mdr/isi/iso/ce marked, niti hand files (21 mm) size- 15-40, for curved canals, pkt. of six mdr/isi/iso/ ce marked, pit & fissure sealant ( 6 ml bottle) solution with high flouride releasing, low viscocity, high retention, rapid cure & low solubility. mdr/isi/iso/ce marked/usfda, preadjusted edgewise stainless steel bracket kit containing upper and lower 2nd premolar to 2nd premolar bondable brackets with upper triple and lower double weldable molar tubes and mbt 0.022 prescription, fiber- reinforced splinting material- bondable reinforced ribben fiber-approx 2mm width mdr/isi/ iso/ce/marked., niti rotary files 4% 21mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be specified at the time of order), addition silicone impression material (600 ml putty with 2 cartridges of 50 ml light body), air rotor spray isi/iso/ce marked, calcium hydroxide, paste system based and catalyst -radiopaque, 4 gm mdr/isi/iso/ce marked, acidulated phosphate fluoride gel 1.25%(apf), gic luting pkt. of 30-35gm powder, flowable composite 2-4 grams, x-ray processing solution(set of developer & fixer powder, manual, to make 13.5 ltr solution), root canal spreaders pkt. of 6 #15-40 21mm, dental chair covering sterilized cling foil rolls mdr/isi/ iso/ce/marked., mta pkt. of 1gm, tooth preparation kit (set of 14 burs), root canal k files 21mm (pkt. of 6) #15-40, dental amalgam capsules pkt. of 50 capsules, impression compound, gic restorative pkt. of 10-15 gm powder, bleaching kit, diamond burs- various shapes including round, tapered round, flat fissure, pear (size and shape of burs required will be specified at the time of order)- coarse / fine grit. pkt of 5, niti rotary files 4% 25mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be spe

corporations/Associations/Others

CTN :39946328

30 Apr, 2025 13.08 Crore

Ahmedabad - Gujarat

Tender For supply of tread rubber precured gsrtc code no.41173 , p.t.r for tubeless gsrtc code no.41177 , p.t.r for tubeless mini tyre pattern gsrtc code no.41176 , bonding gum gsrtc code no.41154 , black vulcanizing solution gsrtc code no.41155

CTN :39941144

21 Apr, 2025 9.64 Lacs

Sira - Karnataka

Tender For supply of hns and stationary to mch sira - hospital compound phenyl_mch sira, soap oil_mch sira, harpic_mch sira, cleaning acid_mch sira, bleaching powder_mch sira, linen detergent powder_mch sira, linen washing soap_mch sira, sabeena powder_mch sira, vim liquid_mch sira, hand battery (big)_mch sira, hand battery (small)_mch sira, hand battery shell (big)_mch sira, hand battery shell (small)_mch sira, plastic dust bin 10 liter_mch sira, plastic bucket 15 liter_mch sira, coconut broom_mch sira, monkey brand broom_mch sira, plastic mug 1 liter_mch sira, bath room cleaning brush_mch sira, plastic dust wiper_mch sira, wet mop with cotton_mch sira, dry mop with cotton_mch sira, both room fresheners (250ml)_mch sira, tube light frame chock and frame combo 20 watt_mch sira, tube light frame chock and frame combo 28 watt_mch sira, tube light 10 square_mch sira, c.f.l bulb 15 watt_mch sira, c.f.l bulb 25 watt_mch sira, room fresheners (240 ml)_mch sira, life boy hand wash liquid (250ml)_mch sira, life boy soap (125gm)_mch sira, dettol liquid (250ml) (250ml pack )_mch sira, sterilium & liquid hand wash_mch sira, bio medical waste bin 10 liter_mch sira, flask 500 ml (thermo flask)_mch sira, tissue paper(long size)_mch sira, door mat 3x6 (size)_mch sira, deck brush_mch sira, mosquito coil_mch sira, mosquito liquid_mch sira, rat mat_mch sira, glass cleaner wiper_mch sira, naphthalene tablet_mch sira, casting soda_mch sira, hypochlorite solution used in hospital_mch sira, superior quality long note book 100 page_mch sira, superior quality long note book 200 page_mch sira, superior quality long note book 300 page_mch sira, superior quality long note book 400 page_mch sira, stapler (small) (each box containing 10 pieces)_mch sira, stapler (big) (each box containing 10 pieces)_mch sira, stapler pin (small) (each box containing 10 pieces)_mch sira, stapler pin (big) (each box containing 10 pieces)_mch sira, file rapper_mch sira, xerox paper a4 (each rim containing 500 sheets) a4 size 21x29.7 cms plain copier paper gsm-80g/m2 thikness-105 micron equals /-5%_mch sira, xerox paper a3 (each rim containing 500 sheets) a3 gsm 120,size- 297 x 420mm (l x b)_mch sira, white paper_mch sira, tag (each box containing 20 pieces)_mch sira, fevistic_mch sira, single punch small (each box containing 10 pieces)_mch sira, single punch big(each box containing 10 pieces)_mch sira, hokar_mch sira, sketch pen (small) (each box containing 14 pieces)_mch sira, sketch pen (big) (each box containing 14 pieces)_mch sira, marker pen (each box containing 20 pieces)_mch sira, superior quality ink pad (big) 155x95 mm marker pen (each box containing 10 pieces)_mch sira, superior quality ink pad (small) 155x95 mm marker pen (each box containing 10 pieces)_mch sira, superior quality postal cover cloth line envelope size 12x10 inch_mch sira, postal cover a4 size_mch sira, parcel covera3 size_mch sira, gum bottle (small)_mch sira, gum bottle (big)_mch sira, pencil_mch sira, attendance register 200pages_mch sira, white transparent file cover_mch sira, file board_mch sira, id card with tag_mch sira, visitor pass (1/32 size) with subject matter printing_mch sira, abark bill books(1/8 size) with printing_mch sira, card board_mch sira, cd marker (each box containing 10 pieces)_mch sira, corban paper_mch sira, inch tape (each box containing 10 pieces)_mch sira, broun tape (each box containing 10 pieces)_mch sira, bind sheets colour (a4 size) _mch sira, khaki files_mch sira, office bill books(1/8 size long) with printing_mch sira, button file plastic_mch sira, with print content a4 (deliver certificate,lab report form, case sheets,diet sheets,abark forms etc._mch sira, with print content a3- format_mch sira, ink bottle (big) _mch sira, file flape size-76mmx76mm (3x3) 150 sheets_mch sira, calculator (display digit-10 display lines 1 type - businesswarranty - 24months net quantity (n)- 1 with new additional features special buttons for grand total (gt), mark up (mu) and correct (igrea

CTN :39794962

19 Apr, 2025 26.90 Lacs

Bhopal - Madhya Pradesh

Tender For supply of raw materials at tyre retreading unit at municipal corporation bhopal - supply of raw materials at tyre retreading unit at municipal corporation bhopal, tyre belt 65/65/450 d12, tyre belt 65/65 d13, tyre belt 185x"14, tyre belt 600x"16, tyre belt 700x"15, tyre belt 700x"16, tyre belt 750x"16, tyre belt 825x"16, tyre belt 900x"20, tyre belt 1000x"20, curing bag 65/65/450 d12, curing bag 65/65 d13, curing bag 185x"14, curing bag 600x"16, curing bag 700x"15, curing bag 700x"16, curing bag 750x"16, curing bag 825x"16, curing bag 900x"20, curing bag 1000x"20, bonding gum, solution drum, cutter blade machine, cutter hand buffing, pins

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39809503

14 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of plumbing items - 1.5 inches cpvc pipes , 1.5 inches cpvc in-trhread brass coupling , 1.5 inches cpvc elbow , 1.5 inches cpvc couplings , 1.5 inches cpvc ball value , 1.5 inches cpvc unions , 1.5 inches upvc t junction , 1.5 inches upvc unions , 1 inches cpvc ball value , 1 inches cpvc tank nipple , 1 inches cpvc in-thread brass , 2 inches x 1 inches cpvc reducer - 2 1e , ashirvad 118 gum solution , teflon tape , hexa blade , 1.5 inches g.i. clamps , 2.5 inches nails , 1.5 inches upvc out-thread couplings , 2 inches pipe , 2 inches elbow , 2 inches couppling , 2 inches mabt , 2 inches fabt , 2 inches union , solution

Adhesive Dressings Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Corporations And Associations And Others

corporations/Associations/Others

Central Government/Public Sector

Central Government / Public Sector