Latest ammonium metavanadate Tenders | Government ammonium metavanadate Tenders

CTN :39959948

23 Apr, 2025 NA

Thiruvananthapuram - Kerala

Tender For supply of chemicals/ biochemicals for tric-kariavattom - chemicals, phospho-tfeb (ser211) (e9s8n) rabbit mab 20 l, cd9 (e8l5j) rabbit mab, cd9 (d3h4p) rabbit mab, tyrosine hydroxylase(e2l6m) rabbit mab, pkh67 green fluorescent cell linker kit for general cell membrane labeling, supersignaltmwest femto maximum sensitivity substrate, trizoltm reagent, dntp set (100 mm), taq dna polymerase, pcr buffer (10x), taq dna polymerase, native, qubittm dsdna hs assay kit, penicillin streptomycin sol, restoretm western blot stripping buffer, dmem powder high glucose, trypsin-edta (0.25%), phenol red, fetal bovine serum, qualified, brazil, pagerulertm plus prestained protein ladder 10 to 250 kda, qubittm rna br assay kit, qubittm assay tubes, qubittm protein and protein broad range (br) assay kits, verso cdna synthesis kit, qubittmrna integrity and quality (iq) assay kit, lysosensor yellow/blue20 x 50 l

Central Government And Public Sector

CTN :39993140

05 May, 2025 10.91 Lacs

Madurai - Tamil Nadu

Tender For tender for supply of dna blood and tissue isolation kit (250 reactions) , type it microsatellite pcr kit (200 reactions) , optical 96 well reaction plates with barcode , optical 8-cap strips (300 per pack) , sequencing 1000 bp , inbios st igm elisa kit , inbios st igg elisa kit , gold nanoparticle (15nm) , zika virus sph2015 ns1 monoclonal antibody hrp , electrode mini polishing kit , carbonate-bicarbonate buffer , phosphate citrate buffer , bovine serum albumin (a4503) , tris buffer (ph7.4) , tetramethyl benzidine (tmb) , gelatin lab grade , tween 20 , bovine serum albumin (a7030) , trizma base (t1503)

Central Government/Public Sector

CTN :39946770

28 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of chemicals - potato dextrose agar, granulated , oat meal agar , di potassium hydrogen phosphate anhydrous , potassium dihydrogen orthophosphate monobasic , gallic acid monohydrate , l methionine , riboflavin , guaiacol , sodium hydroxide pellets , hydrogen peroxide , edta free acid anhydrous , bovine serum albumin , glass wool , folins reagent , sodium carbonate anhydrous , acetone , bradford reagent , dimethyl sulphoxide dmso , methanol , sodium nitrite nano2 , nitrotetrazolium blue choride nbt , hicare non-alcoholic foam hand sanitizer nahs , sterile centrifuge tubes 15 ml , sterile centrifuge tubes 50 ml , freeze tag white dots , freeze tag yellow dots , bluple nitrile gloves medium size , disposable masks

Central Government/Public Sector

CTN :39971076

10 May, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for physics laboratory - rpmi1640 medium. hepes modifcation with l glutamine and 25mm hepes without sodium bicarbonate powder suitable for cell culture , fetal bovine serum non-usa origin sterile fltered suitable for cell culture , ethanol absolute. for analysis emparta acs , trypsin from porcine pancreas lyophilized powder bioreagent , thiazolyl blue tetrazolium bromide powder bioreagent suitable for cell culture suitable for insect cell culture , trypan blue solution , corning syringe flters , lb broth with agar , lb broth miller highly- referenced nutrient-rich microbial growth powder medium suitable for regular e coli culture , ethylene glycol analytical standard , ethylenediaminetetraacetic acid acs reagent , zinc acetate , polyvinylpyrrolidone mol wt number average molecular weight , gadolinium iii nitrate hexahydrate , chromium iii nitrate nonahydrate , cadmium chloride , n n dimethylformamide acs reagent , i sodium citrate anhydrous emprove essential , ascorbic acid , hydrogen peroxide solution , hydrazine hydrate solution , tetra-n- butyl orthotitanate , ferric nitrate nonahydrate , magnesium nitrate hexahydrate , samarium iii nitrate hexahydrate , acetic acid , poly vinyl alcohol pva , samarium iii oxide , niobium v oxide , molybdenum iv oxide , samarium powder for synthesis , cobalt ii chloride anhydrous , nickel ii chloride , lithium chloride , hydrofluoric acid , silver nitrate solution , ammonium hydroxide solution , silicon nanoparticles bid number/ & ( * ) : gem/2025/b/6128335 dated/ + : 09-04-2025 bid document/ 3 3 1 / 35

CTN :39971705

02 May, 2025 NA

Mumbai - Maharashtra

Tender For supply of bovine serum albumin lyophilized powder make: sigma- aldrich (merck)

State Government

CTN :39894898

29 Apr, 2025 NA

Bhubaneswar - Odisha

Tender For supply of sbtc items - blood collection bag cpd-a1 100 ml (single), as per tender specification, blood collection bag cpd-a1 350 ml (single), as per tender specification, blood collection bag cpd 350 ml (triple) with sagm / sagm-2 additive solution, as per tender specification, blood collection bag cpd 450 ml (triple) with sagm / sagm-2 additive solution, as per tender specification, blood collection bag cpd 450 ml (quadruple) with sagm / sagm-2 additive solution (top and bottom), as per tender specification, blood collection bag cpd 450 ml (quadruple) with sagm additive solution (top and top), as per tender specification, transfer bag 100 ml, as per tender specification, hiv (elisa) test kit, as per tender specification, hbv (elisa) test kit, as per tender specification, hcv (elisa) test kit, as per tender specification, hiv (i&ii) rapid diagnostic kit, as per tender specification, hbv rapid diagnostic test kit (serum based), as per tender specification, vdrl rapid diagnostic test kit, as per tender specification, hcv rapid test kit, as per tender specification, anti d (igm only) , with dropper, as per tender specification, anti- d, igm and igg combination, with dropper, as per tender specification, anti a group sera, with dropper, as per tender specification, anti a1 group sera, with dropper, as per tender specification, anti ab group sera, with dropper, as per tender specification, anti b group sera, with dropper, as per tender specification, anti- human globulin (green) polyspecific, with dropper, as per tender specification, anti human globulin, monospecific, with dropper, as per tender specification, anti human globulin, monospecific, with dropper, as per tender specification, bovine serum albumin 22%, with dropper, as per tender specification, anti h, with dropper, as per tender specification, bedside leucofilter, as per tender specification, labside leucofilter, as per tender specification

CTN :39926584

28 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of laboratory materials - thermal printer roll for analyzer , ldl cholesterol cartridge , urea nitrogen cartridge , absorbance test cartridge , ahdl calibrator , albumin cartridge , aldl calibrator , alpl calibrator , alkaline phosphatse cartridge , amylase cartridge , c reactive protein cartridge , calcium cartridge , chem i calibrator , chem ii calibrator , chol calibrator , cholesterol cartridge , ck cartridge , ck mb cartridge , cki mbi calibrator , creatinine cartridge , cuvette cartridge , direct bilirubin cartridge , enzyme calibrator , glucose cartri , hb a1c cartridge glycated haemoglobin , psendo cholinestrase calibrator , pseudocholinesterase cartridge , rcrp calibrator , sample cups , sgot cartridge , sgpt cartridge , total bilirubin cartridge , total protein cartridge , triglycerides cartridge , uric acid cartridge , tbi-dbi calibrator , tp-alb calibrator , dca system for dca vantage hba1c , hdl cholestrol cartridge , biochemistry control level 1 , biochemistry control level 2 , iron cartridge 240 test , urinecsf protein cartridge 80 test , iron tibc , ucfp calibrator 10 , empty cartridge 8 flex , enzyme ii calibrator , free t4 - loci 120 test , tsh - loci 200 test , free t3 - loci 120 test , thyroid calibrator , vit b12 - loci , anemia cal , vitamin d kit , vitamin d calibrator , lactate dehydrogenase , sample probe cleaner , reagent probe cleaner , chemistry wash , hm vessels , hcg cartridge 120 test , hcg calibrator , adazyme for ada , adazyme control level 1 , d dimer turbo kit , d dimer turbo control , g 6pd qualitativea , barium cholride solution 500ml , capillary tube , cleanac , cleanac 3 , esbatchs albuminometer , disposable tip , hemolynac 310 , hemolynac 3n , isotonac 3 , slide washing solution , tissue paper roll size 10 cm , urine stool sputum container , uristitix 12 para , uristix 10 para , uristix 10 para control , uristix 3 para protein , uniplastin system pack , vaccutte empty heparin soduim , vacute na citrate , liquceline e system pack , methyline blue stain 500ml , whatmans filter paper , reticulocyte stain , plasmatrol h1 , plasmatrol h2 , uristix 2 para suger , vacute edta , vacute plain , plain blood collection tube , medipoint , methanol 500ml , micropippette 5 to 50 , distilled water 5 ltr , may grunwald giemsa , coombs antisera antihuman globulin , bovine serum albumin , sulphuric acid h2so4 , methyleted spirit ip , alchol spirit , match box , lable for sputum cups , diamond glass marker pen , lance cleaning papers books , whatmans filter paper 125cm , auto pipette 10 to 1000 , auto pipette stand , pap smear kit , cedar wood oil , reaction cup for hemostar-auto , matrix diluent , hemostar 4cr wash solution , slide keeping box , broom stick , dpx mounting , sol.formalin , hematology controls , matrix ahg card , leishmans stain 500 ml , nebaucer chember , calibrator for 3 part cell counter , plastic bottle wide mouth screw cap , wbc diluting fluid bottle , potassium hydrogen phosphate , sodium phosphate monobasic dihydrate , staining racks . , droppers . , blood group , test tubes holder , beaker , glacial acetic acid , benedict reagent ready , na nitroprusside crystal , liquor ammonia , ammonium sulphate crystal , hay sulphur powder , litmus paper , sternal puncture needle adult size , liver biopsy needle , museum jars with glass lid and glass plate , staining jars for slides , urinometers , graduated cylinders of , graduated cylinders , reagents bottles

Central Government And Public Sector

CTN :39896990

23 Apr, 2025 NA

Parganas - West Bengal

Tender For supply of 29 reagents for alcohol project - sodium tetraborate , trizma hydrochloride , tetraethyl orthosilicate , d plus glucuronolactone , sodium methoxide , perchloric acid seventy percent , hydrogen bromide solution in acetic acid , silver carbonate , barium hydroxide , sulfanilic acid , ammonium persulfate , aniline , acetyl chloride , sodium acetate anhydrous , 1 4 butanesultone , potassium tert butoxide , 3 pentadecylphenol , d glucuronic acid , sodium sulfide , ethyl alcohol pure , four methylumbelliferyl d glucuronide hydrate , four methylumbelliferyl phosphate chemical , ethyl beta d glucuronide solution , bovine serum albumin , human serum albumin , zinc sulphate heptahydrate , manganese ii chloride tetrahydrate , 3 mercaptopropyl triethoxysilane , cetyltrimethyl ammonium bromide ctab

CTN :39901296

23 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dmem hgd 20x500 ml , dmem lgd 10x1l , minimum essential eagle medium 10x1l , fetal bovine serum 500 ml , trypsin from porcine pancrease 25mg

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Ammonium Metavanadate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government And Public Sector

Central Government/Public Sector