Latest ammonium metavanadate Tenders | Government ammonium metavanadate Tenders

CTN :39986298

01 May, 2025 NA

Jammu - Jammu And Kashmir

Tender For tender for supply of expendabe stores - aluminium bar round 12.5mm , aluminium sheet hard 1.22mm , brass foil cold rolled 160x0.10mm , brass folio cold rold 160x0.08mm , brass rod free cutting hexagon 20.00mm , copper rod round 20.0mm , flux welding iron cast , lead ingot , leaded brass rod free cutting hexagon , leaded brass rod round 10.00 mm , leaded brass rod round 12.50 , leaded brass rod round 50.00 mm , leaded brass rod round 6.30 mm , padlocks ig 4 levers 40 mm , padlocks ig 4 levers 75 mm , pin cotter split steel 4.00 x 56mm , pins cotter split steel 1.6mm x 20mm , pins cotter split steel 1.6mm x 25mm , pins cotter split steel 1.6mm x 32mm , pins cotter split steel2.5mm x 25mm , pins cotter split steel2.5mm x 63mm , pins cotter split steel 3.2mm x 25mm , pins cotter split steel 3.2mm x 40mm , pins cotter split steel 3.2mm x 50mm , pins cotter split steel 4.0mm x 32mm , pins cotter split steel 4.0mm x 40mm , pins cotter split steel 4.0mm x 50mm , pins cotter split steel 5.0mm x 80mm , pins cotter split steel 5.5mm x 63mm , pins cotter split steel 6.0mm x 50mm , pins cotter split steel 8.0mm x 71mm , pins cotter split steel 8.0mm x 80mm , rivets countersunk flat 90 degree , rivets snap head copper 6mm x 26mm , rivets snap head copper dia 3 x 20mm , rives snap head steel 6mm x 26mm , rivets snap head steel 6mm x 50mm , rivets solid copper brake band 5mm x 12mm , screw wood slotted csk head mild steel , solder alluminium beedee , solder brazing alloy copper zinc wire , solder brazing alloy silver 14.17g , solder soft grade b , solder soft grade c

CTN :39907875

22 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For rate contract for supply of allied material for reclamationrepairre-build of damaged distribution xmers of various capacities ranging from 25kva to 630 kva in ediii jpdcl for the fy 2025-26 or till next tender is finalized - lt bush rods of brass (m-12), lt bush rods of brass (m-20), lt bush rods of brass (m-30) l.v. bush rods of brass m-30/m-40, ht bush rods of brass (11 kv), lv brass bush rods 12mm ( in exchange of burnt/ damaged one), lv brass bush rods 20mm ( in exchange of burnt/ damaged one), lv brass bush rods 30/40mm ( in exchange of burnt/ damaged one), hv brass bush rods (11kv) ( in exchange of burnt/ damaged one), lv bushings (12mm), lv bushings (20mm), lv bushings (32/30 mm) , ht bushing (11 kv), film paper, lethoride paper/khakhi paper, press boards, gutties, rubber washer of different sizes, ht washers, lt washers m-12, lt washers m-20, lt washers m-30/m-40, cork sheets (1000mmx500mmx5mm), rubberized cork strip(40mmx5mm), bakelite tubes, cotton tape, nawar tape, m.seal, glass sleeves, insulation gum, wooden wedges, craft paper, packing sheets, aluminum gutka, nuts & bolts, h.t. bush clamps, copper brazing rod, aluminum brazing rod, h.t / l.t oil seals-12, h.t / l.t oil seals-20, h.t / l.t oil seals-30/40, cotton waste (old cotton sarres/cloth), m.s washers for l.t connections, plugs of different sizes 1 1 , flux, grey paint, turpentine oil, varnish, welding rods (8mm & 10mm), oven heating/elements coils, 3 multi stands cu cable (10 mm ), thinner, crepe tape, oxygen cylinder (refill), megger (500volt, 5000 mw), oxygen regulator, oxygen cylinder nozzle, oxygen pipe for gas cutter, clamp for oxygen pipe, c clamp 18 , hydraulic transformer lifting trolley, trolley for scrap loading/unloading, clamp meter, welding helmet, welding cable with holder, cutter pliers, screw driver (all sorts), ratchet wrench with socket set compete, pipe wrench 12 , pipe wrench 18 , bolt cutter 12 , bolt cutter 18 , spanner 15/21 mm, spanner 38/48 mm, oven thermostat (0-300 amp), contractor 63 amp isi ,10ka of reputed make, cable wire 16 mm., filter plant high pressure supply hose 25 mm (1 ), 35 bar/500 psi, filter tank pipe rubber, wooden frames for winding of ht /lt, exhaust fans for workshop 24 heavy duties, pedestal fans for workshop (heavy duty), out side clipper for winding machines, inside clipper for winding machines, heavy duty drill machine (1050 watt), scissors (large size for cutting papers), test cell of oil testing machine (60kv) (500 ml/ acrylic test cell) with removable & adjustable electrodes, ht/lt winding machines bearing, ht/lt winding machines bearing vee-belts, ht/lt winding machines bearing gear-box, ht/lt winding machines bearing foot-switch, ht/lt winding machines bearing counters, 1 hp pump motor centrifugal, change over switch 400 amp, mccb 4 pole 100 amp(25ka), scale steel 1 meter, scale steel 12 inch, eot crane switch, angle grinder (850 watts), air blower macine (900 watts), digital micrometer 0 to 25 mm, lpg 19 kg (refill), laminated core of all sorts, multi stand 3 core copper cable 10 sqmm, testing clips, saw dust, dust sand, led light street light150 watt(ip67), led light flood light200 watt(ip67), steel sand buckets, fire extinguisher mechanical foam 50 ltr, fire extinguisher (refill) 50 ltr, oven blower 1450 rpm, twin core 16 sqmm cable (copper), twin core 16 sqmm cable (aluminium)

CTN :39907896

24 Apr, 2025 10.00 Lacs

Srinagar - Jammu And Kashmir

Tender For rate contract for supply of materials for repair of distribution transformers at electrical workshop for the year 2025-26 - supply of :, dpc copper winding wire (round) in sizes 11 to 22 swg-fresh, dpc copper strip of sizes for lv winding of distribution transformers 25 kva to 630 kva-fresh, se copper winding wire (round) in sizes 11 to 22 swg-fresh, dpc aluminium winding wire (round) in sizes from 12 to 20 swg-fresh, dpc aluminium strip of sizes for lv winding of distribution transformers 25 kva to 630 kva - fresh, se aluminium winding wire (round) in sizes 12 to 20 swg-fresh, dpc copper winding wire (round) in sizes 12 to 20 swg ( in exchange of one kg of scrap of salvaged conductor), dpc copper strip of sizes for lv winding of distribution transformers 25 kva to 630 kva( in exchange of one kg of scrap of salvaged conductor), se copper winding wire (round) in sizes 11 to 22 swg ( in exchange of one kg of scrap of salvaged conductor), dpc aluminium winding wire (round) in sizes from 12 to 20 swg ( in exchange of one kg of scrap of salvaged conductor), dpc aluminium strip of sizes for lv winding of distribution transformers 25 kva to 630 kva ( in exchange of one kg of scrap of salvaged conductor), se aluminium winding wire (round) in sizes 12 to 20 swg ( in exchange of one kg of scrap of salvaged conductor), lv brass bush rods 12 mm, lv brass bush rods 20 mm, lv brass bush rods 25 mm, lv brass bush rods 32 mm, press card board soft calendared solid 1mm/2mm/3mm(as per sample), press card board pre compressed solid 1mm/2mm/3mm., press card board gatti, ht insulating gum, glass wool sleeves of sizes, aluminium brazing rod ( standard length), copper brazing rod (standard length), flexible copper strip (shim) 75mm x 0.5 mm, pvc sheets 1 mm thick, empire tape 1, electrical grade kraft paper, 4 mil, lethoride paper 20 mil., hv bushing, lv bushes 250 amp, lv bushes 630 amp, lv bushes 1000 amp, cotton tape 1 (size) 35 m long., nawara tape 1 (size) 35 m long., rubberized cork sheet 4 mm thick 2ftx3ft, rubberized cork sheet 3mm thick 2ftx3ft, bakelite tubes 12mm dia ( 1 mtr long), hv bush clamps (ms), aluminium clamping member (shoes) for hv bushing, lv cork washers 12 mm dia for 100 kva bush with cup, lv cork washers 20mm dia 250 kva bush with cup, lv cork washers 25 mm/30 mm dia 630 kva bush with cup, nuts & bolts (m.s) of sizes., m.s flat washers., hv cork washers 110 mm o.d, aluminium welding flux, aluminium flat 4/6/8/10 mm thick of required, copper flat 4/6/8/10 mm thick of required width., ms plug & caps 1/2 ; 3/4; /1; 1.1/4; 1.1/2, oil seal rings (o-rings) for lv/hvbush rods 12 mm dia., oil seal rings (o.rings) for lv/hv bush rods 20 mm dia, oil seal rings (o.rings) for lv/hv bush rods 25 mm dia, creep tape 1, cotton cloth, m4 grade crgo silicon steel core laminations/stampings duly insulation coated. of required size as per sample, empire sleeves of sizes, synthetic enamel paint smoke grey colour, paint thinner, steel primer, silica gel, transformer oil(servo/power oil), welding rods 3.15 mm/4mm., refilling of oxygen gas for breezing, meggar 500 v 200 mega ohms, 9 v battery, drill bit of sizes, hook on meter, plair 6", wire cutter, refilling of lpg gas for breezing

CTN :39897054

23 Apr, 2025 NA

Bangalore - Karnataka

Tender For supply of wiring harness ca no 3 - qbraiding single core _0_5 sq mm , electrical cable _copper multi conductor tin coated_ptfe insulated with screened single core_0_5 sq mm , electrical cable _copper multi conductor tin coated _film and pvc insulated flexible hookup wire single core_0_5 sq mm_specn_437 , electrical cable copper conductor cotton and pvc insulated_single core scd 6sq mm 911 , electrical cable copper conductor fibrous and pvc insulated _single core scd 0_75sq mm 911 , electrical cable copper conductor fibrous and pvc insulated _single core scd 1_5sq mm 911 , electrical cable copper conductor fibrous and pvc insulated flexible hookup wire_single core , electrical cable copper conductor fibrous and pvc insulated flexible hookup wire_single core scd , electrical cable copper conductor cotton pvc insulated _single core 0_5sq mm 911 , electrical cable_ copper multi conductor tin coated_ plasticized pc v , electrical cable_ copper multi conductor tin coated_ plasticized single core_1_5sq mm 911 scd , electrical cable_ copper multi conductor tin coated_ plasticized pc v core_2_5 sq mm_ spec_ 911_scd , insulating p v c sleeve black__6 mm dia , insulating p v c sleeve white_20 mm dia , insulating p v c sleeve white_10 mm dia , insulating p v c sleeve white_2 mm dia , insulating p v c sleeve white_3 mm dia , insulating p v c sleeve white_3_5 mm dia , insulating pvc sleeve white _5mm dia , insulating pvc sleeve white_14 mm dia , insulating pvc sleeve white_2_5mm dia , insulating pvc sleeve white_20mm dia , insulating pvc sleeve white_28mm dia , insulating pvc sleeve white_6mm dia , insulating pvc sleeve white_8mm dia , insulation tape pvc black _18mm width , iso prophyl alcohol __ ipa_ , locking wire _0_5mm dia , nylon thread white _0_5mm dia , nylon thread white_1 mm dia , palstic cover 80 microns _18_x24_ , permanent marker pen black _fabe rcastle 1523 , potting compound _ana bond 900 , protective conical spring braid_as per drg no a4 _51568 , protective spring braid _as per drg no a__ 51569 , protective spring braid _as per drg no a4 51570 , rubber tube 0_650 mm long _30mm id x 4mm thick , rubber tube 750 mm long black_25 mm id x3_5mm thick , rubber tube black 0_65 long _0_5mm idx1_4mm thick , solder flux _ , solder soft 16 swg _gde _f_ , solider soft 16s w g_sn_63 percent _pb_37 percent , surgical tape _20mm width aluminium alloy connecter with olive drab chromate over cadmium plate with copper bush,and protective cap_s h 16 u 2esh5,jss-50860,asper sample, aluminium alloy connecter with olive drab chromate over cadmium plate with copper bush,and protective cap_shr 16 p2 esh5 jss;50860,as per sample, aluminium alloy connecter with olive drab chromate over cadmium plate with copper bush,and protective cap_shr 32p 12esh1jss:50860 as persample, aluminium alloy connecter with olive drab chromate over cadmium plate with copper bush,and protective cap_shr 36p15 esh5,jss:50860, as persample, aluminium alloy connecter with olive drab chromate over cadmium plate with copper bush,and protective cap_2rm22 kpe 4g3v1. jss:50860, as persample, aluminium alloy connector with olive drab chromate over cadmium plate with copper bush and protective cap _2rm 27kpe 24g1v1 jss:50813 as per sample& drg, aluminium alloy connector with olive drab chromate over cadmium plate with copper bush and protective cap _shr 16 pk 2esh5 jss: 50813 as per sample & drg, aluminium alloy connector with olive drab chromate over cadmium plate with copper bush and protective cap _shr 20p 2eg6 bid details/ 2 / 59

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39848298

24 Apr, 2025 NA

Liluah - West Bengal

Tender For supply of procurement of set of aluminium filler rod and aluminium welding flux as follows : (a) aluminium filler rod, size : dia. 5 mm x 1 meter long, drawing /specification - is:1278/1972 (re-affirmed 2019), type : s-ng2 = 12 kgs. per set, (b) aluminium welding flux, alotectic r-405 of esab or similar of l&t, advani = 0.5 kgs. per set. type of material : aluminium.

Ammonium Metavanadate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector