Latest analytical reagent Tenders | Government analytical reagent Tenders

Central Government/Public Sector

CTN :39986227

21 Apr, 2025 NA

Haridwar - Uttarakhand

Tender For supply of trichloroethylene analytical reagent grade

Central Government / Public Sector

CTN :39992205

02 May, 2025 NA

Murshidabad - West Bengal

Tender For supply of chemical item - phenol solution , propanol , pci solution , dna express reagent , lab solvent , chloroform

CTN :39959948

23 Apr, 2025 NA

Thiruvananthapuram - Kerala

Tender For supply of chemicals/ biochemicals for tric-kariavattom - chemicals, phospho-tfeb (ser211) (e9s8n) rabbit mab 20 l, cd9 (e8l5j) rabbit mab, cd9 (d3h4p) rabbit mab, tyrosine hydroxylase(e2l6m) rabbit mab, pkh67 green fluorescent cell linker kit for general cell membrane labeling, supersignaltmwest femto maximum sensitivity substrate, trizoltm reagent, dntp set (100 mm), taq dna polymerase, pcr buffer (10x), taq dna polymerase, native, qubittm dsdna hs assay kit, penicillin streptomycin sol, restoretm western blot stripping buffer, dmem powder high glucose, trypsin-edta (0.25%), phenol red, fetal bovine serum, qualified, brazil, pagerulertm plus prestained protein ladder 10 to 250 kda, qubittm rna br assay kit, qubittm assay tubes, qubittm protein and protein broad range (br) assay kits, verso cdna synthesis kit, qubittmrna integrity and quality (iq) assay kit, lysosensor yellow/blue20 x 50 l

Central Government/Public Sector

CTN :39762307

15 Apr, 2025 8.00 Lacs

Hyderabad-T - Telangana

Tender For corrigendum : supply of maglunimi analyzer reagents - reaction modules , wash concentration , light check , starter buffer 1plus 2 , system tubing cleaning sol , pm kit , serum total psa kit , serum free psa kit , prostatic phosphatase pap , anti-tpo antobodyi , tga anti tg , serrum ferritin , il-6 , vitamin b12 , folic acid reagent , insulin reagent , islet cell cytoplasmic antibodies , insulinoma associates 2 ia-2 antibody , glutamic acid decarboxylase antibody , toxo igg reagent , toxo igm reagent , rubella igg reagent , rubella igm reagent , cmv igg reagent , cmv igm reagent , hsv half igg reagent , hsv half igm reagent , ana sreen reagent , anti ccp antibody reagent , anti sm igg reagent , anti ds dna iggreagent , fsh reagent , lh reagent , progesterone reagent , estradiol fe3 reagent , testosterone reagent , free testosterone reagent , hs-ctnl reagent , hs-crp , d- dimer reagent , dengue kit bid number/ & ( * ) : gem/2025/b/6058154 dated/ + : 20-03-2025 bid document/ 2 2 1 / 33

Central Government/Public Sector

CTN :39964913

29 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of ammonia solution 30percent grade analytical reagent pack size 5 ltr , hydrochloric acid 35percent ar grade pack size 5 ltr with coa , nitric acid ar grade 69percent pure pack size 2.5 ltr with coa , ammonium bifluoride ar grade with coa , starch soluble ar grade with coa , ordinary filter paper125mm dia grade101 100 circle per pack , filter paper no 40ashless dia12.5cm 100 circles per box , beaker griffen low form with spout 250ml isi marked , air heater heating element 5kw 230by400 cuni 2inch bsp flange.ihcu 50by32 depth of immerson 320mm , perchloric acid ar grade min.70percent assay packing 2.5 litre in glass bottle with coa , apron cotton white colour medium sixe full hand , apron cotton white colour large full hand , apron cotton white colur xl full hand , apron cotton khakhi colur large size half hand , apron cotton khakhi colur xl size half hand , respirators mask model v 44 is 9473 2002 ffp1s , drill bit size 4mm moc carbide tipped , rubber hand gloves 11 inch acid proof for handling conc. acid , copper standard solution 1000 ppm 500 ml for aas use , carbondaum black silicon carbide bench grinding wheel size bore 32mm od 150mm thickness 20mm , muffle furnace fire safety hand gloves made of 575 gsm aluminized para armid heat resistant fabric.11612 2008. heat resistant up to 1000 deg c. size 14inch

Central Government / Public Sector

CTN :39926265

26 Apr, 2025 NA

Murshidabad - West Bengal

Tender For supply of chemical items - microcentrifuge tube 1 and half ml , microtips 10 ml , microtips 200 ml , microtips 1000 ml , pcr microtubes , rt tube , tube strips , rnase a solution , rna express reagent , cdna synthesis kit , emerald anp g pcr mastermix , tb green premix , dna express reagent , recombinant dnase

CTN :39741420

15 Apr, 2025 NA

Betul - Madhya Pradesh

Tender For corrigendum : supply installation and commissioning lab equipments , etc - package1, anemo meter, binocular dissecting microscope, binocular microscope, cod analyser, digital colony counter, digital tds meter, dslr camera, farmel s photometer, ganongs photometer, ganongs respirometer, microscopic camera, moll.s half leaf apparatus, ph meter, slide cabinet with 12 showcase, slide reader, mirowave oven, compound micrscope, dissecting microscope, research microscope with digital photography, micropipette 10, micropipette 20, micropipette 100 l, herbarium cabinet, water and soil testing kit, dna isolation kit, colorimeter, auxanometer, noise level meter, ph electrode, water bath double wall, tissue culture rack, dissolved oxygen meter, slide box 50 slides, dissection kit, osmotic pressure appratus, micro tips 10 l, micro tips 200 l, d.o. meter, digital conductivity meter, ph meter, digital balance, magnetic stirrer, digital colorimeter, melting point apparatus, digital potentiometer, water bath rectangular, polarimeter, refrigerator, reflux condenser, chemical storage rack, h2s gas keep apparatus, vacuum pump, melting point/boiling point apparatus, sprayer with rubber bulb, exhaust fan, desiccator, chromatography jar, mortar and pestle, gas lighter, stop watch, laminar air flow/ laminar hood, electrophoresis unit (horizontal) with power supply, autoclave, gel documentation system, centrifuge, colony counter, homogenizer, incubator (orbital shaking), ph meter (microprocessor based), bod incubator, cod analyser, tds meter, digital thermometer, flame photometer (photo diode sodium, potassium,, soil and water analysis kit, mili-q water purifier, micropipette10 l, micropipette 20 l, micropipette100 l, micropipette1000 l, turbidity meter, stethoscope, sphygmomanomet er, cold box, glucometer, anatomy structure model stomach part (human torso complete), anatomy structure model ent part, anatomy structure model digestive system, anatomy structure model genital and pelvis, colorimeter, pcr tube (tarsons individual pcr tube 0.5 milliliter), micro tip box 10-200 l, micro tip box 100-1000 l, micro tip box 1-20 l, micro tips 200 l, micro tips 1000 l, pcr tube 0.5 l, pcr tube 0.2 l, reagent bottle 100 ml autoclavable, reagent bottle 500 ml autoclavable, eppendorf 15 ml, inoculating loop, petridish 75 mm, falcon tube 15ml, falcon tube 50ml, dna-isolation kit, refrigerated micro-centrifuge, centrifuge tube, thermo-mixer, mortar and pestle, petri dish, dissection kit, nanodrop (biored), conductivity meter, research microscope with digital photography, ultra low temperature lab deep freezer (-80c), analytical balance, ultra centrifuge, deep freezer (-20 degree c) blue star 401-500 liters, refrigerator (4 degree c) double door, electrophoresis unit (vertical) with power supply, thermocycler semi-quantitative, conical flask 100 ml autoclavable, conical flask 500 ml autoclavable, conical flask 1000 ml autoclavable, beaker 50ml, cover slip 10 box, petridish 75mm, beaker 50ml, beaker 250 ml, conical flask 250ml,500ml, water cooler with purifier, rydberg s constant using hydrogen discharge tube, frank hertz experiment, fabry- parot etalon, millikan s oil drop method, pn-junction diode, zener diode, pnp/npn transister(ce and cb mode), jfet, electricalkettle with variable voltages, platinum resistance thermometer, electromotive force of a thermocouple, clement- desorme s method, thermal conductivity using calorimeter, mechanical equivalent using joule calorimeter, critical constant of a gas/vapour, poiseuille s method, maxwell s needle appratus, determination of moment of inertia, determination of force constant of a spring, lcr circuit, determination of poisson s ratio of rubber, lissajous figures with the help of cro, melde s experiment, i- curve byspectrometer, prism using sodium light, newton s ring (plano-convex), liquid using newton s ring, sodium light using plane defferaction grating, polarimeter, resolving power of a telescope, charging and dischar

CTN :39889570

15 Apr, 2025 30.00 Lacs

Multi City - Haryana

Tender For supply of lab reagents and consumables - semi-automactic bio-chemistry analyzer, albumin (5x50ml), alkline phosphtase 4x24 + 4x6ml), bilirubin kit (4x60ml), cholestrol kit (5x30ml), creatinine kit (4x60m)l, ggt (5x6.5ml), glucose kit (5x60ml), hdl kit (4x30ml + 4x10ml), high control for semi auto (1x5ml), normal control for semi auto (1x5ml), sgot kit (4x24ml + 4x6ml), sgpt kit (4x24ml + 4x6ml), total protein (5x50ml), triglycerides kit (4x24ml + 4x6ml), urea kit (4x24ml + 4x6ml), uric acid kit (4x24ml + 4x6ml), wash kit (4x50ml), general lab chemicals and consumables, absolute alcohol 70% (500 ml), almunium slide tray, anti ab, anti d ( igg+ igm), anti human sera/ coombs sera, anti sera abo rh/ blood group test kit (10ml each, total 30ml), anti-d igg 10 ml, anti-d igm 10 ml, aso 50 test titer rapid method, band aid, beaker 1000ml, beaker 100ml, beaker 250ml, beaker 500ml, blood grouping plate, blotting sheet, blue tips, bovine albumin, capillary tubes, card for haemo spot, centrifuge tube stand 15 ml(10*2), centrifuge tube stand 50 ml(15*2), conical flask 500 ml, coplin jars, copper sulphate powder 500gm, covid elisa anigen kit (icmr approved), crp 50 test kit (qualitative), cryo box with lid, cryo vials 2 ml, culture swab stick, diamond marking pencils, disposable alcohol swab, disposable esr pipette, disposable esr tube (westergen method), distilled dionized water 5 ltr, distilled double dionized water 5 ltr, distilled triple dionized water 5 ltr, double blood bag 300 ml, dpx mount, durham tube, edta vial (non vacuum), edta vial (vacuum), eppen drop vial ( mct ), esr black vial (non vacuum), esr black vial (vacuum), esr stand, ethanol absolute, falcon tube, filter paper, filter tip 10 micro litre (1*960), filter tip 100 micro litre (1*960), filter tip 20 micro litre (1*960), filter tip 200 micro litre (1*960), filter tip 5 micro litre (1*960), floride vial (non vacuum), floride vial (vacuum), fouchet reagent, giemsa stain 125 ml, glacial acetic acid, glass bottel round 1000ml, glass bottel round 500ml, glass cover slip 22 mm, glass pipett 10ml, glass pipett 2ml, glass pipett 5ml, glass slide, h & e stain (haematoxillin stain), h.i.v elisa 4th generation (96 test), hand sanitizer 5 ltr (ip base), hbsag card, hbsag elisa 4th generation (96 test), hcv elisa 4th generation (96 test), hcv rapid card, hiv rapid card, hydro chloric acid 500 ml, ice gel pack, j.s.b 1 stain, j.s.b 2 stain, kalazar test rapid card, lancet (auto destroyable/safety lancet), lancet (twisted round), leucoreduction filter, lieshmen powder 25 gm, lugal iodine 125 ml, malaria antigen card, manual rna extraction kit 50 test (icmr approved), mathenol 2.5 ltrs, mct vials 1.5ml, mct vials 2.0ml, measuring cylinder 1000ml, measuring cylinder 100ml, measuring cylinder 20ml, measuring cylinder 500ml, microscope cover glass 22 x 40 mm, micropipette single channel fixed volume fully autoclavable (all size variants), micropipette single channel variable volume fully autoclavable (all size variants), micropipette 8 channel variable volume fully autoclavable (all size variants), micropipette 12 channel variable volume fully autoclavable (all size variants), multistix, n/10 hcl 500ml, naoh sodium hydroxide, og 6, oil immersion 25ml, o-toluidine (500ml), parafilm tape, pastuer pipette, ph paper 5.0 to 7.5, plain vial (non vacuum), plain vial (vacuum), potassium permagnate, ppe kit (citra & drda approved), pregnancy cards/ upt cards, qiaamp dna blood mini kit (250 test), qiaamp viral rna blood mini kit (250 test), quadraple blood bags 450ml, ra factor 50 test kits, rapid antigen detection card test for bacterial meningitis, rapid pap stain kit, rapid test card for cephalosporin, rapid test kit igg, igm, ns1 for dengue, reversible rack mct, rt-pcr flu kit (192 test), rt-pcr hbv quantative kit (192 test), rt-pcr hcv quantative kit (192 test), rtpcr kits 96 test for covid-19 (icmr approved), rubber teat for pipette, salt iodine testing kit, sample cup with label (3 s

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Analytical Reagent Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government / Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector

State Government

Central Government/Public Sector