Latest antioxidant Tenders | Government antioxidant Tenders

CTN :39986567

30 Apr, 2025 22.58 Lacs

Darjeeling - West Bengal

Tender For supply of drugs and pharmaceuticals - e ifa re 14 neomycin polymixin bacitracin neosporin oint , e ifa re 14 neomycin polymixin bacitracin neosporin powder , e ifa re 14 nepafenac 0 dot 3 w v 5 ml ed , e ifa re 14 neurobion forte tab , e ifa re 14 nicotine 2mg tab , e ifa re 14 nicotine transdermal patch 7mg , e ifa re 14 nifedipine 10 mg tab , e ifa re 14 nifedipine retard 10 mg tab , e ifa re 14 nifedipine xl 30 mg tab , e ifa re 14 nimusulide gel , e ifa re 14 nitrofurantoin 100 mg cap , e ifa re 14 nitroglycerin 2 dot 6mg tab , e ifa re 14 nitroglycerin 6 dot 4mg tab , e ifa re 14 norethisterone 5mg tab , e ifa re 14 normal saline 1000 ml , e ifa re 14 normal saline 500ml , e ifa re 14 normal saline fluid sodium chloride 0 dot 9 500 ml , e ifa re 14 nortriptyline 10 mg tab , e ifa re 14 oestrogen conjugated natural oestrogen 0 dot 625mg tab , e ifa re 14 oestrogen cream concentration 0 dot 06 to 0 dot 1 w w tube of 15 to 50 gm , e ifa re 14 ofloxacin ornidazole syrup , e ifa re 14 ofloxacin 0 dot 3 bott of 5 ml , e ifa re 14 ofloxacin orninizole itraconazole clobetasol orniderm cream , e ifa re 14 oin clobetasol salicylic acid dipsalic , e ifa re 14 oint acyclovir skin cream , e ifa re 14 oint beclomethasone salicylic acid , e ifa re 14 oint clobetasole 0 dot 05 salicylic acid 3 dot 5 propylene glycol oint tube of 20gm , e ifa re 14 oint miconazole , e ifa re 14 olanzapine 5 mg tab , e ifa re 14 olmesartan 20 mg tab , e ifa re 14 olmesartan 40 mg tab , e ifa re 14 olopatadine 0 dot 1 bottle of 5 ml e d , e ifa re 14 omega 3 fatty acid cap , e ifa re 14 omega fatty acid antioxidant cap , e ifa re 14 ondansetron 4 mg tab , e ifa re 14 oral teething sol zytee mouth lotion 10ml , e ifa re 14 orciprenaline 10mg tab , e ifa re 14 ornidazole 500mg tab , e ifa re 14 ortho arthritis ankle brace r l , e ifa re 14 ortho arthritis knee brace , e ifa re 14 oxygen mask , e ifa re 14 pancreatine 170 mg activated dimethicone 80 mg tab , e ifa re 14 pantaprozole 40 mg domperidone 10 mg pan d , e ifa re 14 pantoprazole 40mg itopride 150mg cap , e ifa re 14 pantoprazole 40 mg domperidone sr 30 mg cap , e ifa re 14 pantoprazole 40 mg levosulpiride 75 mg cap , e ifa re 14 paraffin soft yellow jar of 4 kg parasoft , e ifa re 14 pcm 250 mg caffein 100 mg ergotamine 1mg prochlorperazine 2 dot 5 vasograin tab , e ifa re 14 pentoxifylline 400mg tab trental bid details/ 2 / 45

CTN :39970960

30 Apr, 2025 NA

Jorhat - Assam

Tender For supply of human insulin glargine inj, 100 iuperml with 5 needles per pen , budesonide 0.5 mg respules , fexofenadine hydrochloride tab 120 mg , glucosamine 250mg with chondroitin sulphate 200 mg cap , immunoglobulin intravenous 5 gm inj , amoxycillin 200mgper5ml with clavulanic acid 28.5mgper 5ml syp , acyclovir 200 mg tab , voglibose 0.3 mg tab , clonazepam 2 mg tab , ivermectin tab 6mg , tab aceclofenac 100 mg , white soft paraffin,liquid paraffin cream , tab amoxycillin 500mg , amoxycillin for oral susp containing amoxycillin base 125mg per 5 ml , anti phlebitis cream tube of 15gper 20g , atorvastatin 40 mg tab , beclomethasone 50 mcg with levosalbutamol 50 mcg mdi , benzoyl peroxide 2.5percentage tube of 20 gm tube , betamethasone 0.05mg and gentamycin sulphate 1mgpergm tube of 5gm , tab clobazam 10 mg , tab fexofenadine 180 mg with monteleukast 10 mg , glycerine suppositories adult size 3g mould , tab amino acid with antioxidant, calcium with lactobacillus , inj amino acid 7 percentage 500 ml , human albumin 20percentage in bott of 100ml , inj phenytoin sodium 100 mgperml , labetalol hcl 100 mg tab , lactobacillus with folic acid ,vit b12 sachet , salmeterol 50mcg, fluticasone 250 mcg rotacaps, pack of 30 , lorazepam 1 mg tab , multivitamin drops having vit a, vit b1, bit b2, b6, vit c, vit d bottle of 15ml , tab thiamin 10 mg, riboflavin 10 mg , pyridoxine3 mg like neurobion , gycerl trinitrate cr 2.6 mg, tab , syp ofloxacin and ornidazole , calcipotriol 0.005 percentage, clobetasol propionate 0.05percentage oint 15 gm , enema sodium phoshate ml 6percentage sod acid phoshate 16percentage 100ml , povidone iodine 5percentage ointment 250 gm jar , tab racecadotril 100mg , tab rosuvastatin and clopidogrel 75 mg , tab amlodipine 5 mg and hctz 12.5 mg , silver sulphadiazine 1percentage cream wperv jar of 500 gms , sodium hypochloride 5 percentage bid details/ 2 / 36

CTN :39970963

30 Apr, 2025 NA

Jorhat - Assam

Tender For supply of tab carbimazole 10mg , tab febuxostat 80mg , tab nifedipine 10 mg , tab sevelamer carbonate 800mg , tab acenocoumarol 3 mg , tab rifiximin 400 mg , inj tetanus toxide amp of 0.5ml single dose , tizanidine 2 mg tab , paracetamol 150mg per ml, 2 ml iv, inj , paracetamol 325mg and ibuprofen 400mg tab , ketorolac 10 mg tab , carbamazepine 200 mg tab , lorazepam 2mg per ml, 2 ml inj , diethylcarbamazine 50mg tab , tinidazole 500 mg tab , lenalidomide 10 mg tab , erythropoeitin human recombinant, 2000 iu , tab with ferrous fumarate with folic acid iron tab , carvedilol 12.5 mg tab , fenofibrate 200 mg tab , simvastatin 20mg tab , atenolol 25 mg tab , amlodipine besylate 5 mg tab , atenolol 50mg with amlodipine 5 mg tab , enalapril 5 mg tab , calamine powder , permethrin 5percentage tube of 30 gm , terbinafine hcl 1percentage lotion bottle of 20 ml , tretinoin 0.025percentage tube of 15gm , dicyclomine hcl 20mg inj , loperamide 2mg tab , doxylamine 10 mg with pyridoxine 10 mg tab , glimepiride 1mg tab , voglibose 0.2 mg tab , estriol 1 mg per gm cream tube of 15 mg , tab amino acid with antioxidant , tab alpha ketoanalogue of aminoacids , valganciclovir 450 mg tab , cream luliconazole, tube of 15 gm , betahistine dihydro chloride 8mg tab , cinnarizine 25 mg tab , clotrimazole 1percentage with lignocaine 2percentage ear drop 10ml , xylometazoline hcl 0.1percentage nasal drop,spray 10 ml , cefixime syp 50mg per5ml bott of 30 ml , cypropheptadine hcl 2 mg per5ml bott of 100 ml , promethazine hcl 25 mg tab , theophylline anhydrous syrup 60mg in 5ml as 100ml bottle. , n acetyl cysteine 600 mg, tab , etophylline 115mg and theophylline 35 mg in slow release form tab , syp diphenhydramine hydrochloride ammonium chloride, sodium citrate,menthol , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 100 ml , linezolid 600 mg tab , sildosin 4 mg tab , sildenafil citrate 50 mg tab , tamsulosin hcl 0.4mg cap , finasteride 5 mg tab , ascorbic acid 500 mg tab , vitamin b complex with vit b1 5mg, vit b6 3mg vit b12 5mcg tab , vit d3, 60,000 iu per 1gm sachet , vitamin e 200 mg cap bid details/ 2 / 49

CTN :39971376

30 Apr, 2025 NA

Aurangabad-Mh - Maharashtra

Tender For supply of mg cap , glycopyrronium 25 mcg smartules , halobetasol 0.05 percent w per v oint 20 gm , haloperidol 0.25 mg tab , haloperidol 5 mg tab , heamatinic tab per cap containing a ferrous fumarate with 100 , human coagulation factor ix 600 iu vial , human insulin 40 iu per vial of 10 ml human actrapid , human insulin analogue glargine inj, 100 iu per ml recombinant , human insulin analogue rapid acting inj, 100 iu per ml recombinant , hydrochlorthiazide 12.5 mg tab , hydrocortisone sodium succininate 100 mg inj vial of 10 ml , hydroxychloroquine 200 mg tab , hydroxyzine 10 mg tab , indapamide sr 1.5 mg tab , infusion normal saline sodium chloride 0.9 percent w per v bott , insulin aspart 30 percent and insulin aspart protamine 70 percent , insulin lispro biphasic 25 per 75 insulin lisopro 25 percent and , insulin syringes with bd ultra fine needle 40u 31g 6mm , insuline pen needle 31g , iron with vitamin b 12 and folic acid bott of 200 ml syrup , isapgol per ispaghula husk 3.5 gm sachet , isotretinoin 10 mg cap , itopride 150 mg tab , itopride 50 mg tab , itraconazole 100 mg cap , ketoconazole 2 percent shampoo bott of 75 ml , ketorolac 10 mg tab , knee cap, elastic large , knee cap, elastic xl , lacosamide 100 mg tab , lactobacillus 1 gm sachet , latanoprost 0.005 percent w per v eye drop bott of 2.5 ml , leflunomide 10 mg tab , leflunomide 20 mg tab , letrozole 2.5 mg tab , levocarnitine 500 mg tab , levo cetirizine 5 mg tab , levodopa 100 mg and carbidopa 10 mg tab , levodopa 100 mg and carbidopa 25 mg tab , levodopa 250 mg and carbidopa 25 mg tab , levofloxacin 500 mg tab , levosabutamol 1.25 mg respules amp of 2.5 ml , levosalbutamol 1.25 mg and ipratropium 500 mcg in 2.5 ml respule , levosalbutamol 50 mcg and beclomethasone 50 mcg inhaler , lignocaine hcl jelly 2 percent tube of 30 gm with sterile tube and , linagliptin 5 mg tab , linezolid 600 mg tab , loperamide 2mg tab , lorazepam 1 mg tab , lorazepam 2 mg tab , loteprednol etabonate 0.5 percent bott of 5 ml , luliconazole cream tube of 15 gm , lumbar corset belt size l , lumbar corset belt size xl , mebeverine hcl 135 mg tab , medroxy progesterone 10 mg tab , mefenamic acid 250 mg and dicyclomine hcl 10 mg tab , memantine 5 mg and donepezil 5 mg tab , memantine 5 mg tab , mesalamine 1 gm sachet , mesalamine 1.2 gm tab , mesalamine suppository , metformin 500 mg and vildagliptin 50 mg tab , methotrexate 10 mg tab , methotrexate 2.5 mg tab , methotrexate 5 mg tab , methylcobalamin 1000 mcg and vitamin b6 pyridoxine 100 mg , methylcobalamin 1500 mcg and alpha lipoic acid 100 mg and myo , methylcobalamin 1500 mcg tab , methylcobalamin 500 mcg tab , methylprednisolone 4 mg tab , metronidazole and chlorhexidine and lignocain oral gel tube , metronidazole 400 mg, tab , miconazole nitrate 2 percent skin tube of 15 gm cream , mirabegron 25 mg tab , mirtazapine 15 mg tab , modafinil 100 mg tab , monteleukast 10 mg tab , montelukast 10 mg and levocetirizine 5 mg tab , moxifloxacin hcl 0.5 percent and dexamethasone 0.1 percent , moxonidine 0.2 mg tab , moxonidine 0.3 mg tab , mupirocin 2 percent oint, tube of 5 gm , mycophenolate 500 mg tab , mycophenolate sodium 180 mg tab , mycophenolate sodium 360 mg tab , naproxen 250 mg tab , naproxen 500 mg tab , nasal decongestant adult drops xylometazoline hcl 0.1 percent , nebivolol 5mg, tab , neomycine powder , nepafenac 0.3 percent w per v eye drop 5ml , neurobion forte tab , nicorandil 10 mg tab , nicorandil 5 mg tab , nifedipine retard 10 mg tab , nifedipine retard 20 mg tab , bid details/ 2 / 116 nintedanib 150 mg soft gelatin capsules , nitrazepam 5 mg tab , nitrofurantoin 100 mg cap per tab , nitroglycerin 2.6 mg controlled release tab , nitroglycerin cr 6.4 mg tab , non sterile gloves medium size , non sterile gloves small size , nor ethisterone 5mg tab , norfloxacin 400 mg tab , nortriptyline 25 mg tab , ofloxacin 200 mg tab , olopatadine 0.1 percent eye drop of 5 ml , omega fatty acid and antioxidant cap , omeprazole 20 mg

CTN :39857510

18 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of antiwear antioxidant type additive

CTN :39858886

18 Apr, 2025 10.65 Lacs

Ferozepur - Punjab

Tender For supply of acebrophyllin 100mg acetycstine 600mg pulmoclear tab , acetaminophen 325 mg plus tramadol 37.5 mg ultracet tab , alovera and vitamin e lotion , alprazolam 0.5 mg tab , amitriptyline 10 mg tab , aripiprazole 5 mg tab , aspirin 75 mg plus atorvastatin 10 mg plus clopidogril 75 mg tab , aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , asthalin respules levolin resp , azelasartan 40 mg tab , baclofen 20 mg tab , betahistine 24 mg tab , brivaracetam 100mg tab , calcium vit d3 syp 200ml bott , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , capesitabine 400mg plus cyclophosphamide 20mg tab , carbamazepine 200 mg cr tab , cefuroxime 500mg plus clavuclonic acid 125 mg tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg , chlorhexidine mouthwash 2 perc bottle of 150 ml , cilinidium plus chlordiazepoxide plus dicyclomine tab , cinitapride 3mg plus pantoprazole 40mg tab , clarithromycin 250mg tab , clobetasol plus gentamicin oint , clonazepam 2 mg tab , clopidogrel 75 mg plus aspirin 75 mg tab , clozapine 100 mg tab , coenzyme q10 100 mg tab , coenzyme q300 mg tab , collagen peptide plus hyaluronate tab , combipack of amoxicillin 750mg plus tinidazole 500 mg plus omeprazole 20 mg hp kit , daflon 500mg diosmin 450mg plus hesperidin 50mg tab , dapagliflozin 10 mg plus metformin 500 mg tab , dienogest 2mg tab , disodium hydrogen citrate syrup , donepezil 5mg plus memantine 10mg tab , drotaverine hcl 40 mg tab , ed bimatoprost 0.01 perc , ed nepafenac 0.1perc w v , ed olopatadine plus ketorolac bott of 10ml , ed potassium iodide sodium chloride and calcium chloride calodin 5 ml , ed travaprost plus timolol bott of 10ml , enteral feed powder protein 85 perc short chain peptides 15perc free amino acids fat 50 perc mct 25 perc vet fat carbohydrate malto destri sht of 126gm , eperisone 50 mg tab , escitalopram 5 mg plus clonazepam 0.5 mg , escitalopram 5 mg plus clonazepam 0.5 mg tab , evening primarose 1000 cap , fenofibrate 200mg plus atorvastatin 10mg tab , flupentixol 0.5 mg plus melitracen 10 mg tab , flurbiprofen 0.03 perc eye drop , fungal diastace plus papaine plus activated charcol unienzyme , ginkgo biloba tab , glimepiride 2mg metformin 500mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glucose powder , heparin 15g 20g oint , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu ml 3 ml pfs , hydrochlorothiazide 12.5 mg tab , indapamide 1.5mg tab , inh beclomethason 200mcg 200 meter dose inh , inh salmeterol 25mcg plus fluticasone 125mcg 120 mdi , inh triohale tiotropium bromide 9 mcg plus formoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj degludec insulin aspart ryzodeg , inj filgrastim 300 mcg , inj human mixtard 30-70 , inj insulin liraglutide 6mg ml 18mg pen , insulin humalog lispro inj recombinan dna origin 100iu mlcartidge , isosorbid 5 mg monontrate 30 mg tab , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 5 mg tab , ketoconazole shampoo , ketoralac 0.2 perc e d , l carnitine 500mg tab , levocarnitine 500 mg tab , lignocain plus gabapentin oint , linagliptin 5 mg plus empagliflozin 10 mg tab , liq paraffin 100 ml bott , losartan 50mg plus hydrochlorthiazide 12.5mg tab , memantine 5 mg plus donepezil 5 mg tab , mesalamine 400 gm tab , metolazone 2.5 mg tab , metoprolol xl 12.5 mg tab , midodrine 10mg tab , minoxidil 5 perc w v lotion 60 ml , mirabegron 25mg plus solifenacin 5mg tab , mirtazapine 7.5 mg tab , montelukast plus bid details/ 2 / 152 levocetrizine plus acebrophylline 200mg tab , multivitamin plus multimineral tab , multivitamin syp , nandrolone deconate 50 mg inj , nasal spray calcitonin 200iu , nepafenac 0.3 perc w v5 ml ed , nifedipine retard 10 mg tab , nitroglycerin 2.6 mgtab , omega 3 fatty acid cap , omega fatty acid plus antioxidant cap , powder clotrimazole 75 gm , propranol 40 mg tab , rabeprazole 20 mg plus levosulpride 75mg tab , rabeprazole

CTN :39846922

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of drug and medicine - tab aceclofenac 100 mg pcm 325 mg chlorozoxazone 250 mg , tab aceclofenac 100 mg pcm 325 mg serratiopeptidase 10 mg , tab acenocoumarol 2 mg , tab betahistine 16 mg , tab cilnidipine 10 mg , tab cilnidipine 20 mg , tab clobazam 10 mg , tab clopidogrel 75 mg aspirin 150 mg , tab clopidogrel 75 mg aspirin 75 mg , tab dapagliflozin 10 mg metformin 500 mg , tab darunavir 600 mg ritonavir 100 mg , tab diclofenac 50 mg paracetamol 325 mg serratiopeptidase 15 mg , tab dicyclomine 20 mg paracetamol 325 mg , tab glucosamine 500 mg diacerin 50 mg , tab glycopyrolate 2 mg , tab iguratimod 25 mg , tab isosorbide mononitrate 30 mg , tab lacosamide 200 mg , tab lacosamide 50 mg , tab methylcobalamine 500 mcg , tab metoprolol 12 point 5 mg , tab moxonidine 0 point 3 mg , multivitamin multiminerals antioxidant soft gelatin tab , tab naproxen 500 mg , tab raltegravir 400 mg , tab rifaximin 200 mg , tab rivaroxaban 10 mg , tab rosuvastatin 10 mg , tab rosuvastatin 20 mg , tab sacubitril 97 mg valsartan 103 mg , tab serratiopeptidase 5 mg , tab sildenafil 20 mg , tab sitagliptin 50 mg , tab tadalafil 10 mg , tab teneligliptin 20 mg , tab ticagrelor 60 mg , tab torsemide 100 mg , tab tramadol 50 mg paracetamol 500 mg , tab tranexamic acid 500 mg mefenamic acid 250 mg , tab pantoprazole 40 mg domperidone 10 mg , timolol maleate 0 point 5 percent preservative free with comod system bid number/ & ( * ) : gem/2025/b/6085181 dated/ + : 27-03-2025 bid document/ 3 3 1 / 37

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39809858

14 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of potassium citrate 1100mg citric acid or mag citrate 300 to 400mcg per 5ml bott of 200 ml , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inhaler of 60 , cefaclor 250 mg cap , cefaclor 500 mg cap , ciprofloxacin 200 mg per 100 ml inj , soft gelatin cap antioxidant containing aronia extract 20per 50mg leutin 5mg zeaxanthibn 1mg vitc20mg vite 5 iu omega 3 fatty acid 500mg docosohexaenoic acid 125mg , hepatitis b vaccine 10 ml , tetanus human immunoglobulline , human diploid cell culture ravice vaccine vial of 1ml , purified chick embryo cell vaccine , purified vero cell rabies vaccine , injectable typhoid vaccine 2 point 50 ml , rabies immune globulin human usp heat treated ampoule ampoule containing not less than 150 iu per ml of human anti rabies immunoglobulin 2 ml ampoule or pfs

Antioxidant Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector