Latest barium carbonate Tenders | Government barium carbonate Tenders

CTN :39986363

01 May, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of isosorbide dinitrate 10 mg tab , itraconazole 100 mg cap , ketamine hcl 50 mg per ml 2 ml inj , ketoconazole 2 percent plus zinc pyrithione 1 percent bottle of 60 ml , labetalol hcl 5mg per ml 4ml inj , levetiracetam 100 mg per ml vial of 5 ml inj , levosalbutamol sulphate 2 point 5 ml containing 1point 25 mg respule , lignocaine hcl 2 percent without adrenaline 30 ml inj , linezolid 600 mg tab , lorazepam 1 mg tab , lorazepam 2mg per ml 2 ml inj , medicated band aid , mephentermine sulphate 30 mg per ml inj , metformin sr 0 point 5gm tab , metoclopramide 10 mg tab , metoprolol 1 mg per ml 5 ml inj , metronidazole 400 mg tab , metronidazole susp 200 mg per 5ml bott of 60 ml , miconazole nitrate cream tube of 30 gm , minoxidil 5 percent lotion bott of 60 ml , mometasone 0 point 1 percent tube of 10 gm , montelukast 10 mg plus levocetrizine 5 mg tab , morphine 15 mg 1 ml inj , moxifloxacin 0 point 5 percent eye drop , multivitamin syp bott of 200 ml , mupirocin 2 percent oint tube of 5 gm , neostigmine 0 point 5 mg 1 ml inj , nifedipine retard 20 mg cap oblique tab , nitrofurantoin 100 mg tab , octreotide 0 point 1mg per ml inj , ointment betamethasone dipropionate 0 point 05 percent and salicylic acid 3 percent tube of 20 grams , ondansetron 2mg per ml 4 ml inj , ondansetron 8 mg tab , ondansetron syp 2 mg per 5ml in bott of 30 ml , ornidazole 500 mg plus ofloxacin 200 mg tab , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape 30 cm , pancuronium bromide 2 mg per ml 2 ml inj , pantoprazole plus domperidone tab , paracetamol 150mg per ml 2 ml iv inj , paracetamol 325 mg plus ibuprofen 400 mg tab , paracetamol 650 mg tab , paracetamol syp125 mg per 5 ml bottle of 60 ml , paracetamol with cysteine hcl monohydrate infusion 1000mg per 100ml , paradichlorobenzene benzocaine chlorbutol and turpentine oil ear drops , pencil cell aa , pencil cell aaa , pethedine 50 mg 1 ml inj , phenytoin sodium 50 mg per ml inj , polidocanal inj , potassium chloride 15 percent inj iv amp of 10 ml 1 point 5 gm , povidone iodine oint tube of 20 gm , prednisolone 40 mg tab , primaquine 7 point 5 mg tab , propranolol tr 40 mg tab , purified chick embryo cell vaccine , purified vero cell rabies vaccine , rabeprazole 20 mg plus domperidone 10 mg tab , rabeprazole 20 mg tab , ranitidine 150 mg tab , serratiopeptidase 5 mg tab , sodium bicarbonate 7 point 5 point amp of 10 ml , soft cervical collar , spinal needle 25 g , spinal needle 26 g , suspensory scrotal , syrup codeine phosphate 10 mg plus chlorphenaramine maleate 4 mg per 5 ml bottle of 100 ml , syrup terbutaline sulphate 1 point 25 mg plus bromhexine hcl 4 mg plus guaiphenesin 50 mg per 5 ml bottle of 100 ml , terbinafine 1percent cream tube of 10 gm , thiopentone inj 0 point 5 gm without water for inj , tinidazole 500 mg tab , tramadol hcl 50mg per ml inj 1 ml amp , tranexamic acid 500 mg tab , tranexamic acid 500 mg per 5ml inj , terlipressin injection 1 mg per 10 ml inj , triamcinolone acetate 10 mg per ml inj , troponin t test card , typhoid vi polysaccharide 0 point 5ml vial oblique pfs , urea cream urea 10 to 12 percent lactic acid 5 to 10 percent in pack of 50 gm , vit d 3 60000 iu per 1gm sachet cholecalciferol , vitamin b complex with a minimum concentration of vit b1 5mg vit b6 3mg and vit b12 5mcg therapeutic tab oblique cap , vitamin b1 b6 and b12 inj neurobion , vitamin e 200 mg cap , vitamin e 400 mg cap , chilblains cream bid details/ 2 / 64

CTN :39724420

18 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For corrigendum : supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), sto

Central Government And Public Sector

CTN :39744065

02 May, 2025 3.91 Crore

Belgaum - Karnataka

Tender For corrigendum : tender for supply of chemical reageants and kits for bims belagavi - stainless-steel-slide-staining-rack-for-sinks-(24inch), sodium-hydroxide, snappak-(sodium potassium lithium ion)91809181,-for-roche-make-electrolyte-analyzer, lh(312201)-for-diasorin-liaison-chemiluminescence-analyzer, deproteinizer----for-roche-make-electrolyte-analyzer, chrome-agar, anti-her-2/erb-b2-receptor-(ready-to-use), anti-human-progesterone-receptor-(pr)-(ready-to-use), anti-human-estrogen-receptor-(er)-(ready-to-use), wooden-slide-box-(100-slide-capacity), tryptone-glucose-extract-agar, thymol-crystal, test-tube-racks-plastic-12-wells-to-hold-18mmx150mm-test-tube, test-tube-(18mm-x-150mm), spirt-lamp, sodium-thiosulphate, sodium-metabisulphite-, sodium-iodate, sodium-electrode-conditioner, scalpel-blade-with-handle, safranin., rf-system-pack---121057, rf-calish-121056, rapid-test-for-occult-blood-, plastic-funnel-large, plastic-coplin-jaras, plain-forceps-small, plain-forceps-long, phosphomoloybdic-acid, measuring-cylinder-plastic/fibre-500ml, light-green-powder, labolene-liquid, iron-alum, hscrp., hexamine, hand-saw, hamacytometer-box, gross-anatomy-probe, ertapenem-10-mcg, cryo-embedding-medium-for-cryostat, crp-xl-system-pack-erba-, crp-xl-system-pack-erba, conical-flasks-boiling-florence-fla-bottom-1000ml-(autoclavable), congo-red, chromic-acid-(chromimum-trioxide-flakes), chlinistrase-reagent-kit, beirbric-scarclet, zinc-dust, yeast-id-for-automated-culture-identification-and-ast-system, xylene/, xld-medium, xl-muticalibrator-erba-xl-system-pack, wilson-blair-agar, wbc-pippettes, wbc-diluting-fluid-, watmans-filter-paper-125mm-roundx100, watch-glass, vdrl-strips, uristicks-ab+swg, urine-keto-sticks, uric-acid-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, uric-acid-erba-xl-system-pack, urea-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, urea-erba-xl-system-pack, urea/, universal-reagent-pack-sensacore-st200-cl-electrolyte-analyzer, ultrasonic-cleaning-indicator, troponin-i-strips, tris-buffer-extra-pure, triglycerides-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, triglycerides-erba-xl-system-pack, tri-sodium-citrate, total-protein-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, total-protein-erba-xl-system-pack, total-cholesterol-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, total-cholesterol-erba-xl-system-pack, total-calcium-erba-xl-system-pack, tissue-paperrolls, tissue-embedding-cassette(plastic), ticarcillin/clavulanic-acid75/10mcg, ticarcillin-75mcg, thioglycolate-fluid-medium, thermal-paper-roll-suitable-for-elisa-machine, thermal-paper-roll-10.5cm, tetracycline-30mcg, test-tubes-75mmx10mm, test-tubes-100mmx12mm, test-tube-washing-brush-small, test-tube-washing-brush-big, test-tube-racks-alluminium-48wells-to-hold-75mmx10mm-test-tube, test-tube-holder-, tcbs-, super-sensitive-polymer--hrp-ihc-detection-kit-(1)-peroxide-block-(6ml-x-1),-(2)mouse-negative-control(3ml-x1),-(3)-rabbit-negative-control(3ml-x1),-(4)-stable-dab-buffer(10ml-x1)-(5)-dab-chromogen(2ml-x1)-(6)super-enhancer-reagent(1x6ml),-(7)poly-hpr-reagent(6ml-x-1),(8)-power-block(6ml-x-1)., sulphur-powder-, sulphanilic-acid, sucrose/, stuart-transport-medium, sterile-swabs-with-screw-capped-tubes, sterile-swabs-for-sample-collection, starch-soluble, staraight-and-cirved-scissors-(short), staraight-and-cirved-scissors-(long), stainless-surgical-trays-(large)-, spirit/, sodium-sulphate(na2so4)anahydrous, sodium-nitroprosside, sodium-dihydrogen-ortho-phosphate, sodium-deoxycholate, sodium-citrate-bulb-3.2%-1.8-ml, sodium-chloride-, sodium-bicarbonate, slides-, simmon-citrate-agar-medium, silver-nitrate, sgpt-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, sgpt/alt-hl-erba-xl-system-pack, sgot-for-erba-mannheim-chembims7-semi-automated-biochemistry-analyzer, sgot/ast-hl-erba-xl-system-pack, semen-diluting-fluid-, selenite-broth, sample-cups-product-code11

Central Government/Public Sector

CTN :39971076

10 May, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for physics laboratory - rpmi1640 medium. hepes modifcation with l glutamine and 25mm hepes without sodium bicarbonate powder suitable for cell culture , fetal bovine serum non-usa origin sterile fltered suitable for cell culture , ethanol absolute. for analysis emparta acs , trypsin from porcine pancreas lyophilized powder bioreagent , thiazolyl blue tetrazolium bromide powder bioreagent suitable for cell culture suitable for insect cell culture , trypan blue solution , corning syringe flters , lb broth with agar , lb broth miller highly- referenced nutrient-rich microbial growth powder medium suitable for regular e coli culture , ethylene glycol analytical standard , ethylenediaminetetraacetic acid acs reagent , zinc acetate , polyvinylpyrrolidone mol wt number average molecular weight , gadolinium iii nitrate hexahydrate , chromium iii nitrate nonahydrate , cadmium chloride , n n dimethylformamide acs reagent , i sodium citrate anhydrous emprove essential , ascorbic acid , hydrogen peroxide solution , hydrazine hydrate solution , tetra-n- butyl orthotitanate , ferric nitrate nonahydrate , magnesium nitrate hexahydrate , samarium iii nitrate hexahydrate , acetic acid , poly vinyl alcohol pva , samarium iii oxide , niobium v oxide , molybdenum iv oxide , samarium powder for synthesis , cobalt ii chloride anhydrous , nickel ii chloride , lithium chloride , hydrofluoric acid , silver nitrate solution , ammonium hydroxide solution , silicon nanoparticles bid number/ & ( * ) : gem/2025/b/6128335 dated/ + : 09-04-2025 bid document/ 3 3 1 / 35

CTN :39920687

14 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of various chemicals - labchem acetic acid glacial ch3cooh , labchem acetone c3h6o , labchem ammonium acetate c2h7no2 , labchem ammonium chloride , labchem ammonium ferrous sulphate , labchem ammonium hydroxide nh4oh , labchem ammonium molybdate nh4 6mo7o , labchem boric acid h3bo3 , labchem edta c10h16n2o8 , labchem hydrochloric acid hcl , labchem hydrofluoric acid , labchem hydrogen peroxide , labchem bromocresol purple i c21h16br2o , labchem ebt indicator , labchem methyl orange indica c14h14n3na , labchem copper pan indicator c15h11n30 , labchem pr indicator c21h14n2o7 , labchem xylenol orange indic c31h32n2o1 , labchem sdps indicator , labchem iso propyl alcohol , labchem labolene cleaning r , labchem mercuric chloride , labchem methanol ch3oh , labchem orthophosphoric acid h3po4 , labchem oxalic acid c2h2o4 , labchem ph buffer tablets ph 4.00 , labchem ph buffer tablets ph 7.00 , labchem ph buffer tablets ph 9.20 , labchem potassium hydroxide koh , labchem quinoline , labchem silicon grease lubricant , labchem silver nitrate agno3 , labchem sodium bi carbonate nahco3 , labchem sodium meta bisulphite na2s2o5 , labchem sodium potassium tartrate , labchem sodium sulphate anhyhrous , labchem stannous chloride sncl2 , labchem stearic acid , labchem sulphuric acid h2so4 , labchem zinc acetate zn ch3co2 2 , labchem zinc oxide , labchem benzene , labchem glycerol 2.5 l ex , labchem methyl red indicator , labchem perchloric acid , labchem sodium nitrate , labchem sodium peroxide granular , labchem tin metal , labchem ammonium oxalate nh4 2c2o4 , labchem ammonium persulphate , labchem ammonium thiocyanate , labchem citric acid c6h8o7 , labchem dimethyl glyoxime c4h8n2o2 , labchem ethanol , chemical anhydrous ferric chloride fecl3 , labchem hydroxylamine hydrochloride , nisp project material bromocresol green , labchem potassium ferricyani k fe cn , labchem sodium bisulphite , labchem sodium fluoride anhydrous , labchem zinc sulphate hepta znso47h2o , labchem benzoin oxime , chromium oxide iii green 500 gm pack , carnauba wax , carborandum powder mesh 400 , carborandum powder mesh 800 , carborandum powder mesh 1000 , carborandum powder mesh 1200 , conductivity standard 12.88us cm , conductivity standard 1413us cm

CTN :39920812

25 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Barium Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government/Public Sector

Central Government/Public Sector