Latest barium chloride Tenders | Government barium chloride Tenders

CTN :39991725

26 Apr, 2025 NA

Ratnagiri - Maharashtra

Tender For supply of furazolidine 25mg per 5 ml , syp.pheniramine maleate each 5ml , syp. calcuim with phosphate 200 ml , syp. iron folic acid 50 ml , syp.metronidazole , syp.ondansetron , syp. paracetamol 125 mg , syp.zinc sulphate or gluconate 50 ml , vitamin a concetrated solution 100 ml , hydrogen peroxide 500 ml , surgical spirit , gel diclofenac , absorbant cotton wool 100 gm roll , absorbant cotton wool 500 gm roll , absorbent surgical gauze 50cmx18 m , adhesive plaster 10 cm x 5 mtr , adhesive plaster 7.5 cm x 5 mtr , auto clave indicator tape label size 6 cm x 2.5 cm , bandage cloth 100 cm x 20 mtr , chromic catgut size 1 0 , chromic catgut with needle size 1 , disposable examination gloves , disposable non traumatic razors , disposable sterile cotton swab , disposable syringes 10 ml with needle , disposable syringes 2ml with needle , disposable syringes 5ml with needle , disposable umbilical cord clamp , elastic adhesive bandage roll of 10 cm x 4 mtr , infusion set , plastic apron , pricking lancet , rolled bandages 10 cm x 4 mtr , rolled bandages 7.5 cm x 4 mtr , scalp vein sets no.18, 21, 22, 23, 24 , kit leptospira , rapid pregnancy testing kit , dengue kit , malaria kit , hbsag kit , rpr test kit , n 10 hydochloric acid , acetic acid solution , reagents - benedicts solution , dipsticks for urine test for protein and sugar , dipsticks for urine test for 10 p , whole blood finger prick hiv rapid test , stains field a composition typically contains a combination of dyes eg eosin and methylene blue or romanowsky-type stains , stains field b typically contains a combination of basic and acidic dyes eg a mixture of eosin, methylene blue, and other romanowsky-type stains , anti abd kit , barium chloride , micropipette , yellow tips for micropipette , specimen collection bottles , plastic dropper , digital hemoglobino meter , digital hemoglobino strips , glucometer , glucometer testing strips , pre- sterilewide mouth plastic container with screw cap 20ml with label , pre- sterilewide mouth plastic container with screw cap 100ml plastic container , tourniquet , wooden spatula , slide drying rack , test tubes glass , glass rods , glass slide box of 25 slides , curtain , blood lipid test strip dry chemistry , glycohemoglobin test kit , rapid test for qualitative detection of antibodies to s typhi igm igg , buckets big plastic , bucket small plastic , dustbin blue , red , black , spirit lamp , test tube holding clamp , test tube rack , wash basin with elbow tap , cusco speculam , examination table with lithotomy position arrangement , table top centrifuge , pathological microscope binacular , lamp with stand spot examination light , sponge holding forcep 6inch , beak forcep , edta tube collection bulbs , plain tube collection bulbs , cover slip , biodegradable biomedical waste bag, yellow, colour , biodegradable biomedical waste bag, white colour , biodegradable biomedical waste bag, blue colour , biodegradable biomedical waste bag, red colour , metoprolol tablet (q2) capsule (q2) , clobazam tablets (v2) (q2) tablet (q2) , ondansetron tablet (q2) , pantoprazole injection (q2) injection (q2) , donepezil tablet (q2) , amiodarone tablets (v2) (q2) (q2)

State Government

CTN :39790096

29 Apr, 2025 NA

Guwahati - Assam

Tender For corrigendum : empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii

Central Government/Public Sector

CTN :39964598

30 Apr, 2025 NA

Parganas - West Bengal

Tender For supply of merck chemicals - ammonium acetate , barium chloride dihydrate , paraffin liquid light , 2 propanol , sodium acetate anhydrous , triethanolamine , tri sodium citrate dihydrate , acetic acid glacial , ammonia solution , magnesium oxide light , boric acid , methyl orange indicator solution , phenolphthalein indicator solution , ammnium molybdate tetrahydrate pure

CTN :39908999

17 Apr, 2025 3.37 Lacs

Multi City - Karnataka

Tender For supplying of lab chemicals to general hospital bilagi, bagalkote dist - n/10 hcl 500ml_gh bilagi, c reactive protien (crp) _gh bilagi, hbsag kit_gh bilagi, probe clenar_gh bilagi , h 360 stomatolizer_gh bilagi, h 360 diluent_gh bilagi, sodium citrate tubes_gh bilagi, st 200 electolute reagents_gh bilagi, hba1c_gh bilagi, uric acid_gh bilagi, crp kits_gh bilagi, blood lancets_gh bilagi, sulho salicylich acid_gh bilagi, alkaline phosphate_gh bilagi, total protein_gh bilagi, sgpt_gh bilagi, sgot_gh bilagi, searum albumin_gh bilagi, barium chloride _gh bilagi, searum bilirubin_gh bilagi, fouchets reagent_gh bilagi, sodium hypochlorite solution_gh bilagi, n/10 hcl_gh bilagi, cover slips_gh bilagi, immersion oil_gh bilagi, clotted test tube big_gh bilagi, clotted test tube small, edta tubes big_gh bilagi, edta tubes small_gh bilagi, plastic micro tips 200-1000_gh bilagi, plastic micro tips 2-200_gh bilagi, filter paper_gh bilagi, glass slides_gh bilagi, esr tubes_gh bilagi, aslo kit_gh bilagi, ra kit_ghbilagi, serum creatinine kit_gh bilagi, glucose kit_gh bilagi, sodium hypochlorite sol_gh bilagi, small microtips_gh bilagi, big microtips_gh bilagi, tissue paper roll_gh bilagi, distilled water_gh bilagi, clotted test tube_gh bilagi, plastic test tube_gh bilagi, urine strips 2 para_gh bilagi, serum electrolyte reagent_gh bilagi, lipid profile hdl_gh bilagi, lipid profile triglycerides_gh bilagi, lipid profile s.cholesterol_gh bilagi, burea_gh bilagi, serum creatinine_gh bilagi, widal kit_gh bilagi, vdrl kit_gh bilagi, lancets box of 100_gh bilagi, fouchets reagent 125ml_gh bilagi, barium chloride 500ml_gh bilagi, printer role 5.5mm, urine containarssmalll 30ml non sterile , urine strips (g+p) _gh bilagi, smt test tubes_gh bilagi, glass slides pack of 100_gh bilagi, mantoux kit_gh bilagi, ra kit_gh bilagi, vdrl cards_gh bilagi, k3 edta_gh bilagi, cell clean 50ml_gh bilagi, sultolyser 500ml_gh bilagi, wdf lysercell 5lt_gh bilagi, flurocell 42ml_gh bilagi, cell pack 20lt_gh bilagi, pm kit_gh bilagi, detergent 5lt_gh bilagi, diluent 20lt_gh bilagi, distilled water 10 ltrs can_gh bilagi, citrate tubes_gh bilagi, plastic test tubes_gh bilagi

State Government

CTN :39200933

19 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Barium Chloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector