Basic Organic Chemical Tenders

Get complete information related to latest Basic Organic Chemical Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Basic Organic Chemical Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Basic Organic Chemical Tenders .

Filter

Loading....

Get Tender in Email

CTN :42191751

27 Oct, 2025 NA

Nashik - Maharashtra

Tender For bid to ras corrigendum : supply of dglp re 19 lab and bta d d - liquor formaldehyde 40 percent wv , glycerine ar glycerol , microprotein kit 50 ml , printer paper roll for semi auto analyzer 55 mm , filter paper round circular 110 mm , pencil marking glass diamond marker , molecular grade absolute alcohol ethanol , pttk reagent 5 ml , pm kit for semi auto analyzer , eight check system control 3x1 dot 5 ml , westergren disposable esr pipette pack of 100 , paraffin wax melting point 56 degree celsius , pt reagent 12x5 ml , urine multi strips for clinitek advantus siemens bott of 100 , ana test kit rapid 25 test , c reactive protein kit for 50 test , ra factor test kit 35 test , pa coliform kit for water culture mac conkey pack of 10 test , reticulocyte stain ready made , sugar set for bacterial identification ready made , eight check sysmex calibrator , cytochrome stain leishman , bio rad chemistry control l1 12x5 ml , bio rad chemistry control l2 12x5 ml , nitric acid , nichrome wire loop , potassium hydroxide pellets , india ink , methyl alcohol methanol , faecal occult blood kit fobt 10 test , erba e lyte 580 control , erba e lyte 580 calibrator , kit for mycobacterium tuberculosis for molbio pcr 20 tests , trinicheck control for coagulation l1 2 and 3 , seliwanoff reagent for fructose estimation of semen analysis 100 ml , micropipettes tips for 1-200 ul pkt of 1000 , slide, microscope, thickness 1 dot 15 to 1 dot 35 mm, size 75 mm x 25 mm , hcv elisa kit advanced 3rd generation , filter paper large 2 feet x 2 feet , blood collection bag single with cpd-a anticoagulant 49 ml for 350 ml blood , lancet disposable pre-sterilized size 10 , serum anti human globulin , serum haemagglutinating gp dot a anti-b monoclonal , serum haemagglutinating gp dot b anti-a monoclonal , serum haemagglutinating gp dot c anti-ab monoclonal , serum anti a1 , serum anti h , serum anti d igg , test tube length 8 cm x 13 mm internal dia with rim , non ionised deionised distilled water , temperature recorded pen for blood storage refrigerator rem , temperature recorded pen for blood storage refrigerator terumo penplo , liss coombs card card by column agglutination technology cat compatible with matrix get card system 01x24 test , abo rh forward reverse grouping card by column agglutination technology cat compatible with matrix get card system 01x24 test , microcuvettes for haemoglobinometer mispa hbxmicrofluidic chip , temperature recorded pen for blood storage refrigerator spencers , rpr screening for vdrl test kit 01 x 100 test , sysmex control 1 dot 5x3 ml , cell clean sysmex 1x 50ml , cell pack sysmex 1x20 ltr , stromatolyser sysmex 1x500ml , elite h 580 lyse 1 //bid details 2 / 49

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Loading, Please wait...

Basic Organic Chemical Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector