Web Analytics Made Easy - StatCounter

Bell Alarm Tenders

Get complete information related to latest Bell Alarm Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Bell Alarm Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Bell Alarm Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

State Government

CTN :42452592 Due date: 31 Oct, 202531 Oct, 2025 NA
Tender For procurement of flow sensor adult spu ,hpo filter ,expiratory membrane cl ,battery c1 ,hepa filter c1 ,expiratory membrane c2 ,battery c2 ,hepa filter c2 ,oxygen cell ,power cable

CTN :42411082 Due date: 01 Nov, 202501 Nov, 2025 NA
Tender For supply of pulse oximeter,rechargeble cell aa,oxygen flowmeter,bp moniter mercury,vital bp cuff,vital bp cuff with bladder

State Government

CTN :42418499 Due date: 13 Nov, 202513 Nov, 2025 2.00 Crore
Tender For supply of mechanical ventilator,disposable inbuilt dual heater wire and humidifier chamber ventilator circuit infant size,disposable inbuilt dual heater wire and humidifier chamber ventilator circuit pediatric size,niv mask non vented infant,niv mask non vented pediatric,niv mask vented infant,niv mask vented pediatric,disposable flow sensors if proximal flow sensor is required,heated humidifier,pediatric test lung,oxygen cell,reusable expiratory valve or cassettee,disposable expiratory bacterial or viral filter,disposable nebulizer kit,etco2 adaptor,high flow nasal cannula infant,high flow nasal cannula pediatric,cmc for first year,cmc for second year,cmc for third year,cmc for fourth year,cmc for fifth year,cmc for sixth year,cmc for seventh year,cmc for eight year

State Government

CTN :42402124 Due date: 11 Nov, 202511 Nov, 2025 NA
Tender For supply of main board for agilia sp syringe pump,force sensor for agilia sp syringe pump,battery for agilia sp syringe pump,display for agilia sp syringe pump,keypad for agilia sp syringe pump,flow sensor cable for sle 4000 to 5000,flow sensor for sle 5000 hf ventilator,oxygen cell for sle 4000 to 5000,power supply board for injectomat agilia syringe pump,disengagement lever switch for agilia for injectomat agilia syringe pump,force sensor with cable for injectomat agilia syringe pump,keypad cover kit,display board for injectomat agilia syringe pump,rechargable batteery pack 6 v for syringe pump injectomat agilia

State Government

CTN :42305516 Due date: 05 Nov, 202505 Nov, 2025 NA
Tender For supply of icu ventilator high end c c - icu ventilator high end , humidifier servo controlled with digital monitoring of inspired gas temperature with heating wire , reusable humidifier chamber , oxygen cell or sensor , trolley for each ventilator with circuit holding arm , air and oxygen hose , disposable breathing circuit adult , disposable breathing circuit pediatric , reusable and autoclavable silicon breathing circuit adult , reusable and autoclavable silicon breathing circuit pediatric , niv mask reusable small , niv mask reusable medium , niv mask reusable large , reusable flow sensor adult , reusable flow sensor neonatal , disposable flow sensor adult , disposable flow sensor neonatal , disposable hme filter adult , disposable hme filter pediatric , exhalation valve or expiratory cassette reusable autoclavable , exhalation valve or expiratory cassette disposable , disposable t type nebulizer kit , cmc first year , cmc second year , cmc third year , cmc fourth year , cmc fifth year , cmc sixth year , cmc seventh year , cmc eighth year

Central Government/Public Sector

CTN :42306399 Due date: 05 Nov, 202505 Nov, 2025 21.34 Lacs
Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

CTN :42154085 Due date: 30 Oct, 202530 Oct, 2025 NA
Tender For lab equipments - lab equipments, imported binocular microscopes, portable water/soil kit, digital bod incubator, digital microscope with lcd screen and built in camera microscope , built in camera microscope, digital haemoglobinometer (hbmeter), imported trinocular microscopes, autoclave, deep freezers 100 liter, imported trinocular microscopes, water analyzer with colorimeter, d.o. meter, condu-ctivity, tds, ph, salinity and temperature, autoclave, activity tds ph and temperature (water analyzer with colorimeter, d.o. meter, condu-ctivity, tds, ph, salinity and temperature ), digital thermal cycler pcr, dissolved oxygen meter, cod analyzer with digestor, flame photometer, semi automatic microtome, interactive uhd led board, distilling apparatus condenser, semi automatic finecare immunoassay analyzer, electronic micro balance, viscocitymeter bath, digital flame photometer with solution and compressor, digital potentiometer, ultrasonic interferometer, uv visible spectrophotometer, phase contrast microscope, hot air oven universal msw 211, water bath rectangular single walled msw-271, heating mantle msw-431, bunson burnars, burret stand, hot plate magnetic stirrer, double stage vacuum pump, digital flame photometer dual channel, columns for columns chromatography, polarimeter, digital abbe refractometer, ft-ir spectrometer this instrument is operated by a pc with user friendly software and a comprehernsive mannual, mixer / grinder, blotting paper, ganongs potometer, farmer s potometer, ganong light screen, ganongs respirometer, wilmots bubler appratus, arthron reagent, micropipet, acetone gas jar, farmerse photometer, stage micrometor, gas cylinder, 5 liter copper ghada, freeze /doubal door( 230 lit.), bm slide cabinate(capacity2000 slides size 15x18x3, cooling centrifuge (thermo scientific), scepter cell counter (merck millipore), spectrophotometer, microtome rotary, bactrial colony count, tlc apparatus, osmotic pressure apparatus, seed germinattormsw 124, humidity & temperature control cabinetmsw125, plant growth msw130, tissue culture rack msw-168, function generator, dual trace cro, study of elastic constant, susceptibility measurements, study o frank and hertz experiment, study of calcite prism, four probe methods, fourier analysis, oscilltors - wein bridge/hartley, study of ac oustical and optical modes, di electric constant, pn junction diode, e/m by thomsons method, study of solar cell, e/m by zeeman effect, hall effect, newtons ring app, rydbergs constant, gm counter, michelson interferometer, febry parot interferometer, rocks, minerals and fossils showcase almirah with glass, satellite imagery, gps wireless pocket receiver for survey or geologist (s750 model), projector, fossils, fossils, micro scope ( petrological polarized microscope), 3d models ( structural geology), geological brunton compass with black lather case compass (black), digital camera, thin section of rocks slide, thin section of rocks slide, resistivity meter, slide film projector, india/asia/mp /world map physical and political, (tracing table with stand), (plumb bomb), prismatic compass, tripod stand, tape 50m, plain table tripod stand steel,sampatal wood set, simple aluminum alloy and fork, trough compas, engineering chain 100 feet, classical globe, theodo light complete set (tripath stand steel, reading scale, solar system automatic, french curve, natural map of the world in hindi 3d with frame, world political map in hindi 3d with frame, physical map of india in hindi 3d with frame, political map of india hindi 3d with frame, natural map of madhya pradesh in hindi 3d with frame, political map of madhya pradesh in hindi 3d with frame, inverter + battery, water cooler with ro, sanitary vending machine
 Loading, Please wait...

Connect us via What's Up