Latest blood grouping reagent Tenders | Government blood grouping reagent Tenders

State Government

CTN :39919589

19 Apr, 2025 NA

Patiala - Punjab

Tender For lab kits consumables and other items for rajindra hospital patiala - paper roll, pti kt, g6pd kits, methanol 2.5ltrs bottles, leishman stain powder (bottel), 10% sodium hypchlorite (liters), liquid paraphin (bottels), retic stain (bottels-125 ml), spirit (liters), test tubes, micro capillary tubes (box ), slides (box), westergren pipttes, edta vaccutainers, plain vaccutainer, sodium flouride, pti vaccutainer, esr vaccutainer, urine containers, syringe (20ml), syringe (10ml), syringe (5ml), syringe (2ml), disp.gloves( 7.5), disp.gloves( 7.00), disp.gloves( 6.5), cotton (bundles), bone marrow needle (no.14, bone marrow needle (no.16, bone marrow needle (no.18, jamshidi needle, lignocane 2% 30ml (bottels), micropore (pc), betadine (bottles), urine strips (box), nitrile gloves (box), blotting sheet 2 bundles (1000 sheets ) boxes, cover slip boxes, gentamicin 120mg hlg (vials), ceftazidime + clavulanic acid (30mg+15mg) (vials), ciprofloxacin (30 mg) (vials), ceftriaxone (30 mg)(vials), teicoplanin (30mg) (vials), azithromycin (30mg) (vials), cefoperazone + sulbactam (30 mg+15mg) (vials), nutrient agar (500 gms) boxes, potato dextrose agar (100 gms) boxes, nutrient gelatin (100gms) boxes, of basal media (100 gms) boxes, nitrate broth (100gms) boxes, cled agar with andrade s indicator (500gms) boxes, corn meal agar (500 gms) boxes, hi chrome candida differential agar (100gms) boxes, dextrose (500gms) boxes, sucrose (500gms) boxes, mannitol (500gms) boxes, lactose (500gms) boxes, acetone (litre x 5), lead acetate (500 gm), acid carbolic (500 gm), acid sulphuric (2.5l ), acid acetic, disodium hydrogen phosphate (500 gm), ferric chloride ar (500 gm), glycerine (500 gm), toluidine (gm), i- phenylalanine (500 gm), neutral red (125 gm), acid fuchsin ( 25 gm), basic fuchsin (25gm), potassium tellurite (25gm), sodium taurocholate (500 gm), sodium hydroxide (500 gm), di potassium hydrogen orthophosphate (500 gm), methyl red reagent (100ml), andrade s indicator (100ml), alpha napthylamine (500gm), potassium iodide (100gm), sulphanillic acid 0.8% (100 ml), n, n, n ,n- tetramethyl-p-phenylenediamine dihydrochloride (5g), potassium hydroxide (500gm), widal test kit 4x5ml (to,th,ah,bh) (kits ), crp latex slide agglutination kit (50 tests), ra latex slide agglutination kit (50 tests), aso latex slide agglutination kit (50 tests, ppd 5 tu/ 0.1 ml & 10 tu/0.1 ml (vial), upt strip test, toxoplasma strip test, rpr strip test, hav rapid card, hev rapid card, hep b core antibody igm and igg elisa, rubella igm elisa, cmv igg elisa, hsv-1&2 igm - elisa, petri dish 3 (pc), petri dish 4 (pc), petri dish 4"disposable (pc), durhams tube, over slips (20 boxes (400 packets), blood culture bottles (50ml) 1367019 (bottles), blood culture bottles (160ml) 1367019 (bottles), whatman filter paper rim, filter paper rim (ordinary) (rim), gloves (pair), masks (disposable ), heating elements (autoclave) (elements), insulin syringes, t3 (96 wells), t4 (96 wells), tsh (96 wells), vitamin d 3 (96 wells), lh (96 wells), fsh (96wells), prolactin (96 wells), testosterone (96 wells), psa (96 wells), ca-125 (96 wells), cea (96 wells), ca-15.3 (96wells), alpha fetoprotein (afp) (96wells), ca-19.9 (96 wells), ferritin (96wells), insulin (96 wells, beta hcg (96 wells), amylase, cpk-mb (20x1.1 ml), ldh (20x1.1 ml), cpk total(ck-nac) (15x1.1 ml), phosphorous (2x50 ml), calcium (2x50 ml), micro protein kits for csf (1x50 ml), blood urea kit (2x1 litre), uric acid (4x50 ml), cholestrol 5x20ml, triglycerides 5x20ml, sgot 5x20, sgpt 5x20, alp 5x20 ml, glucose 2x200 ml, total bilirubin 4x50 ml, ammonium sulphate 500gm/(ar) ( packs), disodium phenyl phosphate 100gm per pack (ar) ( packs), trichloracetic acid (tca) ar 500gm ( packs), methanol (ar) 2.5 ltr per pack ( packs), trisodium citrate (ar) 500gm per apck ( packs), methylated sprit (ar) 5lrt per apck ( packs), sodium dihydrogen phosphate (nah2po4) (ar) ( packs), sulphur powder ar 500gm per pack ( packs), liquor ammonia ar 250 m

CTN :39920687

14 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of various chemicals - labchem acetic acid glacial ch3cooh , labchem acetone c3h6o , labchem ammonium acetate c2h7no2 , labchem ammonium chloride , labchem ammonium ferrous sulphate , labchem ammonium hydroxide nh4oh , labchem ammonium molybdate nh4 6mo7o , labchem boric acid h3bo3 , labchem edta c10h16n2o8 , labchem hydrochloric acid hcl , labchem hydrofluoric acid , labchem hydrogen peroxide , labchem bromocresol purple i c21h16br2o , labchem ebt indicator , labchem methyl orange indica c14h14n3na , labchem copper pan indicator c15h11n30 , labchem pr indicator c21h14n2o7 , labchem xylenol orange indic c31h32n2o1 , labchem sdps indicator , labchem iso propyl alcohol , labchem labolene cleaning r , labchem mercuric chloride , labchem methanol ch3oh , labchem orthophosphoric acid h3po4 , labchem oxalic acid c2h2o4 , labchem ph buffer tablets ph 4.00 , labchem ph buffer tablets ph 7.00 , labchem ph buffer tablets ph 9.20 , labchem potassium hydroxide koh , labchem quinoline , labchem silicon grease lubricant , labchem silver nitrate agno3 , labchem sodium bi carbonate nahco3 , labchem sodium meta bisulphite na2s2o5 , labchem sodium potassium tartrate , labchem sodium sulphate anhyhrous , labchem stannous chloride sncl2 , labchem stearic acid , labchem sulphuric acid h2so4 , labchem zinc acetate zn ch3co2 2 , labchem zinc oxide , labchem benzene , labchem glycerol 2.5 l ex , labchem methyl red indicator , labchem perchloric acid , labchem sodium nitrate , labchem sodium peroxide granular , labchem tin metal , labchem ammonium oxalate nh4 2c2o4 , labchem ammonium persulphate , labchem ammonium thiocyanate , labchem citric acid c6h8o7 , labchem dimethyl glyoxime c4h8n2o2 , labchem ethanol , chemical anhydrous ferric chloride fecl3 , labchem hydroxylamine hydrochloride , nisp project material bromocresol green , labchem potassium ferricyani k fe cn , labchem sodium bisulphite , labchem sodium fluoride anhydrous , labchem zinc sulphate hepta znso47h2o , labchem benzoin oxime , chromium oxide iii green 500 gm pack , carnauba wax , carborandum powder mesh 400 , carborandum powder mesh 800 , carborandum powder mesh 1000 , carborandum powder mesh 1200 , conductivity standard 12.88us cm , conductivity standard 1413us cm

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

CTN :39911349

23 Apr, 2025 NA

Delhi - Delhi

Tender For supply of anti - d blood grouping reagent (q2)

corporations/Associations/Others

CTN :39889131

09 Apr, 2025 4.71 Lacs

Delhi - Delhi

Tender For procurement of reagents and chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi - supply of reagents & chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi.ammonium chloride (500 gm), tri-ammonium citrate (500 gm), ammonium ferrous sulphate (500 gm), ammonium buffer solution (500 gm), boric acid ar (500 gm), bromocresol green soln. (125 ml), calcium chloride fused (500 gm), carbon tetrachioride(500 gm), di-potassium hydrogen ortho phosphate (500 gm), dithizone (5 gm), ethyl acetate (500 ml), ferric chloride (500 gm), ferrous sulphate crystalline (500 gm), haxane ar (500 ml), hydrochloric acid (500 ml), lead nitrate (500 gm), macconkey broth (500 gm), silver nitrate n/50 solution (500 ml), mercuric oxide(red/yellow) (100 gm), mercuric sulphate (250 gm), methyl red indicator soln.(125 ml), nitric acid (500 ml), methyl blue indicator alkaline (125 ml), paraffin wax 58-60 & 60-62 (500 gm), petroleum ether(bp 40-60c) (500 ml), phenol crystal(500 gm), phenolpthalen indicator solution (125 ml), 1.10 phenanthroline monohydrate (ferroin indicator) (5 gm), potassium dichromate ar(500 gm), potassium lodate(250 gm), potassium lodide(250 gm), potassium nitrate anhydrous ar(500 gm), potassium permanganate(500 gm), potassium sulphate (500 gm), silver sulphate(25 gm), sod.azide(100 gm), sodium chloride(500 gm), sodium meta bisulphite(500 gm), sodium nitrate(100 gm), sod.sulphite(500 gm), sod.thiosulphate(500 gm), sodium hydrogen phosphate(500 gm), stannous chloride(250 gm), sulphamic acid(500 gm), thymol blue indicator soln. (pack of 125 ml), edta n/50solution (500 ml)

CTN :39897909

23 Apr, 2025 NA

Delhi - Delhi

Tender For supply of anti - d blood grouping reagent (q2)

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

CTN :39594296

03 Apr, 2025 NA

Kota - Rajasthan

Tender For tender for supply of tablet divalproex 250 mg , dns fluid 500 ml , tablet domperidone 10 mg , tablet donepezil 5 mg , dorzolamide 2 percent plus timolol 0.5 percent eye drop , tablet doxophylline 400 mg , capsule doxycycline 100mg , capsule duloxetine 20mg , tablet duloxetine 30 mg , tablet dutasteride 0.5 mg , ear drop chloramphenicol 5 percent clotrimazole 1 percen betamethasone 0.25 percent lignocaine hcl 2 percent in bottle of 5 ml , eye drop brinzolamide plus brimonidine , eye drop brinzolamide 1 percent , eye drop brinzolamide 1.0 plus timolol 0.5 percent 5 ml , eye drop bromfenac , eye drop carboxymethyl cellulose 1 percent bottle of 5 ml , eye drop ciprofloxacin plus dexamethasone , eye drop dorzolamide 2 percent , eye drop fluconazole 0.3 percent , eye drop flurbiprofen sodium 0.3 percent 5 ml , eye drop hydroxy propyl methylcellulose plus dextran plus glycerin plus polysorbate 80 with polyquad preservative , eye drop loteprednol 0.5 percent plus moxiflox 0.5 percent , eye drop olopatadine plus ketorolac , eye drop travoprost 0.004 percent , tablet entecavir 0.5 mg , tablet eplerenone 25 mg , tablet escitalopram 10 mg plus clonazepam 0.5 mg , tablet escitalopram 10mg , tablet esomeprazole 40 mg , tablet etizolam 0.5mg , tablet etophyllin 115 mg plus theophyllin 35 mg sr 150 mg , tablet evening primrose 500 mg , eye drop tobramycin 0.3 percent 5 ml , eye oint ciprofloxacin , eye oint hypromellose 2 percent hydroxypropyl methyl cellulose 2percent ocular lube , tablet ezetimibe 10 mg , tablet febuxostat 40mg , tablet fenofibrate 160mg , tablet fexofenadine 120mg , capsule fluconazole 150 mg , tablet flunarizine 10 mg , tablet fluoxetine 20mg , tablet flupentixol 0.5 mg plus melitracen 10 mg , nasal spray fluticasone propionate 50 mcg bp , tablet fluvoxamine 50mg , foleys catheter 2 way size 14 fr , foleys catheter 2 way size 16 fr , foleys catheter 2 way size 18 fr , tablet folic acid 5 mg , rotacap formoterol 6mcg plus budesonide 400mcg , fosfomycin sachet 3gm , framycetin sulphate cream bp 1 percent cream 15 or 20 gms , tablet frusemide 20 mg plus spironolactone 50 mg , tablet frusemide 40 mg , oint or cream fusidic acid , tablet gabapentin 100mg , tablet gabapentin 300mg , gamma benzene hexachloride 1 percent plus cetrimide 0.1 percent lotion 100ml gbhc , eye drop gatifloxacin 0.3 percent bott of 5 ml , tablet ginkgo biloba , tablet gliclazide 30 mg mr , tablet gliclazide 40 mg , tablet gliclazide 60 mg mr , tablet glucosamine 500 mg plus diacerein 50 mg , tablet glucosamine 500 mg , tablet glyceryl nitrate 2.6 , cream halobetasol plus fusidic acid , ointment halobetasol 0.05 percent , tablet heamatinic containing ferrous fumarate vit b-12 folic acid and vit c comma strength 300mg comma 1.5mg comma 75mg min , injection heparin 5000 iu per ml , injection human insulin analogue rapid acting 100 iu per ml recombinant dna origin 3 ml pfs , tablet hydralazine 37.5 plus isosorbide dinitrate 20 mg , tablet hydrochlorothiazide 12.5 mg , tablet hydrochlorothiazide 25 mg , tablet hydroxychloroquine 200 mg , tablet hydroxyzine 25 mg , tablet ibandronic acid 150mg , capsule imatinib 400 mg , tablet indapamide sr 1.5 mg , injection pheniramine 22.75 mg per ml , injection adrenaline 1 ratio 1000 1 ml , injection atropine 0.6 mg comma 1 ml , injection dextrose 25 percent , injection diclofenac 25mg per ml 3ml , injection dicyclomine 20 mg , injection erythropoietin recombinant human 2000 iu , injection etophylline 84.7 mg plus theophylline 25.3mg per ml , injection human insulin glargine 300iu per ml 3ml cart , injection hydrocortisone sodium succinate 100 mg , injection insulin isophane nph 50 percent plus human insulin soluble insulin 50 percent mixtard 50 ratio 50 , injection iron 500mg ferric carboxymaltose , injection iron sucrose , injection methotrexate 25 mg 2 ml , injection methylcobalamin 1000mcg plus vitamin b6 pyridoxine 100mg plus nicotinamide 100mg , injection methylcobalamin 1500 mcg , injection metoclopramide 5mg per

CTN :39856104

07 Apr, 2025 2.50 Lacs

Multi City - Karnataka

Tender For purchasing of chemicals consumables to chemistry research center gec ramanagara-, , zinc nitrate hexahydrate [zn(no3)2. 6h2o], , cerium nitrate hexahydrate [ce(no3)3. 6h2o], , chromium nitrate nonahydrate [cr(no3)3 .9h2o], , cobalt nitrate hexahydrate [co(no3)2.6h2o], , copper nitrate hexahydrate [cu(no3)2.6h2o], , silver nitrate [agno3], , titanium nitrate [ti(no3)4], , magnesium nitrate hexahydrate [mg(no3)26h2o], , nickle nitrate hexahydrate [ni(no3)26h2o], , cadmium nitrate [cd(no3)2], , chromium (iii) nitrate nonahydrate [cr(no3)3.9h2o], , sodium nitrate (nano3), , sodium nitrite (nano2), , strontium nitrate [sr(no3)2], , bismuth nitrate [bi(no3)3)], , iron nitrate (ferric nitrate) [fe(no3)3.(h2o)n], , zirconium nitrate [zr(no3)4], , gadalonium nitrate [gd(no3)3], , tin (iv) chloride pentahydrate [sncl45h2o], , titanium isopropoxide [ti{och(ch3)2}4.], , niobium (v) nitrate [nb(no3)5], , ammonium nitrate (nh4no3), , zinc sulphate (znso4), , copper sulphate (cuso4), , magnesium sulphate heptahydrate (mgso4.7h2o), , nickle sulphate hexahydrate (niso46h2o), , chromium sulphate hexahydrate [cr2(so4)36h2o], , cerium sulphate hexahydrate [ce(so4)26h2o], , manganese acetate tetrahydrate [mn(ch3coo)24h2o], , zinc acetate heptahydrate [zn(ch3coo)27h2o], , zinc acetate hexahydrate [zn(ch3coo)26h2o], , chromium acetate [cr(ch3coo)2], , tetraethyl orthosilicate (teos) [si(oc2h5)4], , sodium silicate (na2sio3), , sodium metasilicate pentahydrate [na2sio35h2o], , sodium metavanadate [navo3], , vanadyl sulphate hydrate [voso4.xh2o], , chromium sulphate [cr2(so4)3], , ammonium, , tungstate, , pentahydrate, , [(nh4)10(h2w 12042)5h2o], , ammonium vanadate (nh4vo3), , sodium tungstate dihydrate (na2wo4.2h2o), , tungsten hexacarbonyl [w(co)6], , tungsten hexachloride (wcl6), , sodium bicarbonate (nahco3), , sodium hydroxide (naoh), , sodium chloride (nacl), , sodium sulphate (na2so4), , sodium lauryl sulphate (sls), , sodium dodecyl sulphate (sds), , cetyl trimethyl ammonium bromide (ctab), , boric acid (h3bo3), , ammonium hydroxide (nh4oh), , ammonium chloride (nh4cl), , hydrochloric acid (hcl), , sulphuric acid (h2so4), , ethylenediaminetetraacetic acid (edta) [c10h16n2o8], , potassium hydroxide (koh), , ethanol (c2h5oh), , urea [nh2conh2], , glycine [c2h3no2], , 2, , 4, , citric acid [c6h8o7], , acetone [ch3coch3], , nickel mesh (to prepare working electrode), , nickle foam, , 6, , nafion [c7hf13o5s c2f4], , 7, , whatmann filter paper (no. 41), , tissue paper (laboratory grade)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Blood Grouping Reagent Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

corporations/Associations/Others

Central Government/Public Sector