Latest butene Tenders | Government butene Tenders

CTN :39856104

07 Apr, 2025 2.50 Lacs

Multi City - Karnataka

Tender For purchasing of chemicals consumables to chemistry research center gec ramanagara-, , zinc nitrate hexahydrate [zn(no3)2. 6h2o], , cerium nitrate hexahydrate [ce(no3)3. 6h2o], , chromium nitrate nonahydrate [cr(no3)3 .9h2o], , cobalt nitrate hexahydrate [co(no3)2.6h2o], , copper nitrate hexahydrate [cu(no3)2.6h2o], , silver nitrate [agno3], , titanium nitrate [ti(no3)4], , magnesium nitrate hexahydrate [mg(no3)26h2o], , nickle nitrate hexahydrate [ni(no3)26h2o], , cadmium nitrate [cd(no3)2], , chromium (iii) nitrate nonahydrate [cr(no3)3.9h2o], , sodium nitrate (nano3), , sodium nitrite (nano2), , strontium nitrate [sr(no3)2], , bismuth nitrate [bi(no3)3)], , iron nitrate (ferric nitrate) [fe(no3)3.(h2o)n], , zirconium nitrate [zr(no3)4], , gadalonium nitrate [gd(no3)3], , tin (iv) chloride pentahydrate [sncl45h2o], , titanium isopropoxide [ti{och(ch3)2}4.], , niobium (v) nitrate [nb(no3)5], , ammonium nitrate (nh4no3), , zinc sulphate (znso4), , copper sulphate (cuso4), , magnesium sulphate heptahydrate (mgso4.7h2o), , nickle sulphate hexahydrate (niso46h2o), , chromium sulphate hexahydrate [cr2(so4)36h2o], , cerium sulphate hexahydrate [ce(so4)26h2o], , manganese acetate tetrahydrate [mn(ch3coo)24h2o], , zinc acetate heptahydrate [zn(ch3coo)27h2o], , zinc acetate hexahydrate [zn(ch3coo)26h2o], , chromium acetate [cr(ch3coo)2], , tetraethyl orthosilicate (teos) [si(oc2h5)4], , sodium silicate (na2sio3), , sodium metasilicate pentahydrate [na2sio35h2o], , sodium metavanadate [navo3], , vanadyl sulphate hydrate [voso4.xh2o], , chromium sulphate [cr2(so4)3], , ammonium, , tungstate, , pentahydrate, , [(nh4)10(h2w 12042)5h2o], , ammonium vanadate (nh4vo3), , sodium tungstate dihydrate (na2wo4.2h2o), , tungsten hexacarbonyl [w(co)6], , tungsten hexachloride (wcl6), , sodium bicarbonate (nahco3), , sodium hydroxide (naoh), , sodium chloride (nacl), , sodium sulphate (na2so4), , sodium lauryl sulphate (sls), , sodium dodecyl sulphate (sds), , cetyl trimethyl ammonium bromide (ctab), , boric acid (h3bo3), , ammonium hydroxide (nh4oh), , ammonium chloride (nh4cl), , hydrochloric acid (hcl), , sulphuric acid (h2so4), , ethylenediaminetetraacetic acid (edta) [c10h16n2o8], , potassium hydroxide (koh), , ethanol (c2h5oh), , urea [nh2conh2], , glycine [c2h3no2], , 2, , 4, , citric acid [c6h8o7], , acetone [ch3coch3], , nickel mesh (to prepare working electrode), , nickle foam, , 6, , nafion [c7hf13o5s c2f4], , 7, , whatmann filter paper (no. 41), , tissue paper (laboratory grade)

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39308199

02 Apr, 2025 4.10 Crore

Kolkata - West Bengal

Tender For corrigendum : carrying out various electrical works for part a and part b as per standard specification by providing all required materials in connection with the composite works for setting up of hpg-2, butene-1 and psa units at lepetkata, assam of m/s. bcp

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39466793

26 Mar, 2025 NA

Auraiya - Uttar Pradesh

Tender For corrigendum : supply of ex-works price of butene including gst in rs/mt[ i. e. v+ f+ gst] , freight charges of butene including gst in rs/mt (freight+ gst)

CTN :39657632

01 Apr, 2025 6.20 Crore

Kolkata - West Bengal

Tender For carrying out various instrumentation works for part a as per standard specification by providing all required materials in connection with the composite works for setting up of hpg-2, butene-1 and psa units at lepetkata, assam of m/s bcpl-instrumentation"pressure gauges and accessories (excl. supply of impulse pipe / tubing materials)"installation of line mounted or remote mounted or local gauge board mounted pressure gauge/ pressure gauge with pulsation dampener / syphon / over-range protector (direct / surface mounted / diaphragm seal type) inclusive of mounting of instrument, supply and erection of supports / tray, mounting on support (if support required), laying of capillary on tray, fabrication and installation of manifolds / impulse lines with supports as per standards indicated below, hydraulic testing and painting of supports but exclusive of supply of instrument, gauge board, yoke, piping material and calibration.in stainless steel as per standard 7-52-0432/1112in carbon steel as per standard 7-52-0432/1112in carbon steel as per standard 7-52-1222in carbon steel as per standard 7-52-1210in carbon steel as per standard 7-52-0433/1113in carbon steel as per standard 7-52-1120in carbon steel as per standard 7-52-0459/1158"pressure instruments (excl. supply impulse pipe / tubing materials)"installation of pressure transmitters/ pressure switches (with or without pulsation dampener, over-range protector)/ diaphragm seal type pressure transmitters/ diaphragm seal type pressure switches including mounting on yoke/ surface, supply of supports for capillary, supply and erection of supports for impulse lines wherever required, fabrication and installation of manifolds/ impulse lines with supports as per standard indicated below, laying of capillary on supports, hydraulic testing and painting of supports but exclusive of supply of instrument, piping/tubing materials, all electrical/ pneumatic connections, yoke and calibration.in carbon steel as per standard 7-52-0437/0438/1131/1132in carbon steel as per standard 7-52-1222in carbon steel as per standard 7-52-1223in carbon steel as per standard 7-52-2103in stainless steel as per standard 7-52-1223in carbon steel as per standard 7-52-1143in stainless steel as per standard 7-52-1143"differential pressure instruments (excl. supply of impulse pipe/tubing materials)"installation of differential pressure transmitters (including one side capillary type)/ differential pressure switch(including one side capillary type)/ diaphragm seal type dp transmitters/ diaphragm seal type dp switch including mounting on yoke/ surface, supply and erection of supports for impulse lines wherever required, fabrication and installation of manifolds/ impulse lines with supports as per standard indicated below, supply and fabricating of supports for capillary, laying of capillary on supports, painting, installation of flushing connection, hydraulic testing of impulse lines as per standard indicated below but exclusive of supply of instrument, piping material, all electrical/ pneumatic connections, yoke and calibration.in carbon steel as per standard 7-52-0452/1171in carbon steel as per standard b348-7-52-4062in stainless steel as per standard b348-7-52-4062in carbon steel as per standard b348-7-52-4063"differential pressure (flow) transmitters (excl. supply of impulse pipe/tubing material)"installation of differential pressure(with or without integral manifold)/ diaphragm seal type differential pressure flow instruments including mounting on yoke, supply of supports for impulse lines/ manifolds/ capillary, fabrication and installation of manifolds/ impulse lines with supports as per standard indicated below, laying of capillary on supports, hydraulic testing and painting of supports but exclusive of supply of instruments, piping material, all electrical/ pneumatic connections, yoke and calibration.in carbon steel as per standard b348-7-52-3339in carbon steel as per standard 7-52-1305in stainless steel as per

Central Government/Public Sector

CTN :39616767

29 Apr, 2025 NA

Multi City - Multi State

Tender For jp/b925-000-ep-t-9801/1001 - epcc package of polypropylene and butene-1 unit of bina petchem and refinery expansion project(bprep) of m/s bharat petroleum corporation limited (bpcl)

Central Government/Public Sector

CTN :39566442

29 Apr, 2025 NA

Multi City - Multi State

Tender For jp/b925-000-ep-t-9801/1001 - epcc package of polypropylene and butene-1 unit of bina petchem and refinery expansion project(bprep) of m/s bharat petroleum corporation limited (bpcl)

Butene Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector