Tender For supply of immun blot pvdf membrane - hisep tm lsm1077 , tris base , tris glycine sds buffer , immun blot pvdf membrane , clarity ecl substrate , precision plus protein , sodium dodecyl sulfate
Tender For supply of d ifa re 13 decapeptide 10mg lot 10ml bott , d ifa re 13 diphtheria tetanus acellular pertussisdtap single dose vaccine , d ifa re 13 inj gadobutrol 1dot0mmolml 10ml vial , d ifa re 13 umbilical catheter 3dot5 fr , d ifa re 13 tracheostomy tube 8mm with cuff and two inner cannula , d ifa re 13 sodium perborate monohydrate 50 ww solution parasafe , d ifa re 13 inj noval rabies monoclonal antibody containing docaravimav and miromavimab 1500iu2dot5ml , d ifa re 13 locking reconstruction plate 3dot5mm titanium 14 hole with twelve 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 10 hole with ten 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 12 hole with twelve 3dot5mm locking head screws , d ifa re 13 neonatal central venous triple lumen catheter central line size2dot5fr , d ifa re 13 cpap disposable tubing with water chamber and humidifier chamber , d ifa re 13 bipolar marryland vessel sealer 5mm , d ifa re 13 neonatal central venous triple lumen catheter central line size3dot0fr , d ifa re 13 endopath endoscopic bowl clamp with ratchet , d ifa re 13 disposable perforator for craniotomy atraumatic tip 14mm , d ifa re 13 thalidomide 100mg cap , d ifa re 13 antimicrobial skin cleaning wipes polyhexanide based pack of 1012 wipes , d ifa re 13 vitb complex forte with ascorbic acid cap , d ifa re 13 cyclosporine 50mg tabcap , d ifa re 13 thiocolchicoside 4mg captab , d ifa re 13 vit d3 100 iu folic acid 1mg mayoinositol 2000mg sachet5 gm each pack of 30 , d ifa re 13 glycolic acid 6 cream 30 gm tube , d ifa re 13 octinoxateniacinamideglycolic acid 3kojic acid dipalmitatearbutinmulberry extract1 tocopheryl acetateallantoinlicoric extract tetrahydrocurcumin30gm , d ifa re 13 crystal trichloroacitic acid 100 , d ifa re 13 gel sunscreen gel spf40 60gmoctinoxatediethylamino hydrobenzoyl hexyl benzoatebisethyloxyphenol methoxyphenyl microfine , d ifa re 13 hair rremoval contains watermineral full nomenclature in pdf format , d ifa re 13 hand disinfectant 32dot5 gm propanolol1 18 gm etahol 0dot1 gm glutaraldehyde bott of 250 ml liq , d ifa re 13 liquid disinfectant each 05 lit contains sodium chloride 605 gm potassium chloride 10 gm sod bi carbonate 15 gm in buffer solution qs and stabilizer qs can of 5 ltrsterisol , d ifa re 13 betamethasone 0dot05 zinc sulfate 0dot5 lotion 50ml bott , d ifa re 13 desonide 0dot05 ww gel 20gm , d ifa re 13 paracetamol 500mg caffeine 65mg tab , d ifa re 13 neomycin pulv bott 5 gm , d ifa re 13 serum vit k under eye serum 30 ml , d ifa re 13 ketoconazole ichthyal pale dpanthenol alovera 10 75ml shampoo , d ifa re 13 diazepam suppository , d ifa re 13 paracetamol 250mg suppository , d ifa re 13 surgical scrub 2 chlorhexidine in 70 ethyl alcohol without any moisturizers bott of 500 ml , d ifa re 13 cefpodoxime oral suspension , d ifa re 13 ofloxacin orinidazole syp 30 ml bottle , d ifa re 13 oseltamivir 12mgml syp , d ifa re 13 alfuzocin 10mg dutasteride 0dot5mg tab , d ifa re 13 amoxycillin 250mg clavulanic acid 50mg tab , d ifa re 13 calcium carbonate 250 tab , d ifa re 13 itopride 100mg tab , d ifa re 13 chlordiazepoxide 5mg clinidium 2dot5mg tab , d ifa re 13 mesalamine 200mg tab , d ifa re 13 metalozone 5mg tab , d ifa re 13 montelukast 10mg tab bid details/ 2 / 46
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76