Web Analytics Made Easy - StatCounter

Chemical Compound Tenders

Get complete information related to latest Chemical Compound Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Chemical Compound Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Chemical Compound Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :38600845 Due date: 09 Jan, 202509 Jan, 2025 NA
Tender For supply of alt-r crispr-cas9 crrna (sbe1 g1: taatactccaaacaccaaac) , alt-r crispr-cas9 crrna (sbe1 g2: tcaaacatggtaatggagtg) , alt-r crispr-cas9 crrna (sbe1 g3: gattcgtggggctcggggtt) , alt-r crispr-cas9 crrna (sbe1 g4: cttgggtttacaggttctgg) , alt-r crispr-cas9 crrna (sbe2 g1: gagaggggcatccctccacc) , alt-r crispr-cas9 crrna (sbe2 g2: tacaggaagtgttgaagagc) , alt-r crispr-cas9 crrna (sbe2 g3: ggaaatcaatccactcaggg) , alt-r crispr-cas9 crrna (bam9 g1: gttgggactactcaagggca) , alt-r crispr-cas9 crrna (bam9 g3: cttgagtagtcccaacacgg) , alt-r crispr-cas9 crrna (bam3 g1: ggaaaggatgactggggcca) , alt-r crispr-cas9 crrna (bam3 g2: aaggggtgatggtggatgct) , alt-r crispr-cas9 crrna (bam3 g3: gctttcctgaataccactct) , alt-r crispr-cas9 crrna (pram g1: cagcaaccgatttgatcccg) , alt-r crispr-cas9 crrna (pram g2: gttccagacttggctaaagc) , alt-r crispr-cas9 crrna (pram g3: cacaatattctgatggcacg) , alt-r crispr-cas9 crrna (st23 g1: tggcacggggaatctagaca) , alt-r crispr-cas9 crrna (st23 g2: cgggaaaccggactataacc) , alt-r crispr-cas9 crrna (a48 g1: gaaggaacgacctccagaaa , alt-r crispr-cas9 crrna (a48 g2: taaccgtcgctgggatctat) , alt-r crispr- cas9 crrna (a75 g2: atcacaatcaagatccgcat) , alt-r crispr-cas9 crrna (sp g1: gcacggttcgagaagagatc) , alt-r crispr-cas9 crrna (sp g2: tgaactgcttcctcggcacg) , alt-r crispr-cas9 crrna (sp g3: ggcagaaactacgaacgaag) , alt-r crispr-cas9 crrna xt , alt-r crispr-cas9 tracr rna , alt-r s. p. hifi-cas9 nuclease v3 , nuclease free duplex buffer (10 2 ml) , idte (1x te solution; 10 2 ml) bid number/ ( ( ) ) : gem/2024/b/5712833 dated/ * : 16-12-2024 bid document/ 2 2 1 / 20

Central Government And Public Sector

CTN :38556433 Due date: 03 Jan, 202503 Jan, 2025 NA
Tender For supply of pbs ph 7 4 500ml , tmb solution ready to use , carbonate bicarbonate buffer for elisa ph 9 6 , 0 5 10ul microtips with filter with rack box 960 tips by case , sodium chloride 500gm , spectra por 131090t biotech grade dialysis tubing trial kit 0 5 1 0 kdalton 16 mm , borosilicate glass petridishes 90mm x 17mm 10 pieces per pack , tmb substrate solution make himedia

Central Government And Public Sector

CTN :38556367 Due date: 02 Jan, 202502 Jan, 2025 1.50 Lacs
Tender For supply of 50x tae buffer tris acetate edta electrophoresisbuffer , 3 8 diamino s ethyl 6 phenyl phenanthridinum bromide solution , dna blood mini kit 50 , agarosepowderforelectrophoresis500gm , tube5xseqbuffersmalleach , 100bpdnaladder50ug , cryotags13x19mm

State Government

CTN :38465142 Due date: 03 Jan, 202503 Jan, 2025 NA
Tender For tender antibodies and consumables at department of pathology kgmu lucknow - antibodies & consumables, cd la (bv605), cd la (apc), cd la (pe), cd2 (pe-cy7), cd2 (pe), cd2 (bv605), cd2 (fitc), cd3 (per cp-cy5.5 (uchti clone), cd3 pe (ucht1 clone), cd3 (bv605 (sk7clone), cd3 (bv711), cd3 (apc-r700(sk7 & ucht1 clone), cd3 (apc-h7), cd3 (v500c), cd3 (fitc), cd3 (percp-cy5.5), cd4 (v450), cd4 (apc-r700), cd4 (pe-cy7, cd4 (apc), cd4 (fitc), cd4 (pe), cd5 (percp-cy5.5), cd5 (pe), cd5 (fitc), cd5 (apc), cd7 (apc-r700), cd7 (fitc), cd7 (apc), cd7 (bv711), cd8 (apc-h7), cd8 (bv786), cd8 (fitc), cd8 (percp-cy5.5), cd10 (apc), cd10 (pe), cd11c (apc), cd13 (pe), cd14 (apc-h7), cd15 (fitc), cd15 (bv711), cd16 (pe-cy7), cd16 (percp-cy5.5), cd16 (pe), cd19 (pe-cy7), cd19 (fitc), cd19 (pe), cd19 (apc), cd20 (v450), cd20 (fitc), cd20 (apc-h7), cd22 (pe), cd22 (percp-cy5.5), cd22 (bv711), cd22 (apc), cd23 (apc-r700), cd23 (fitc), cd23 (pe), cd23 (apc), cd25 (apc-h7), cd25 (percp-cy5.5), cd25 (apc-r700), cd25 (fitc), cd25 (bv786), cd26 (apc), cd26 (pe), cd27 (apv-h7), cd27 (bv605), cd27 (bv510), cd30 (fitc), cd33 (percp-cy5.5), cd33 (apc), cd33 (pe), cd34 (apc), cd34 (percp-cy5.5), cd34 (pe), cd34 (apc-r700), cd36 (bv605), cd 38 apcr700, cd 38 bv 605, cd38 (v450), cd38 (apc), cd38 (bv786), cd38 (apc-h7), cd38 (bv421), cd38 (fitc), cd38 (percp-cy5.5), cd42a (fitc), cd45 (v500), cd45 (apc-h7), cd45 (fitc), cd48 (fitc), cd49d (bv711), cd52 (apc-h7), cd52 (bv421), cd56 (apc), cd56 (pe-cy7), cd56 (percp-cy5.5), cd56 (apc-r700), cd56 (pe), cd58 (fitc), cd61 (fitc), cd71 (apc-h7), cd71 (fitc), cd71 (apc), cd73 (bv605), cd73 (v450), cd73 (fitc), cd73 (pe), cd79a (pe), cd79a (percp-cy5.5), cd79a (apc), cd79b (percp-cy5.5), cd81 (apc-h7), cd94 (pe), cd103 (bv421), cd103 (bv711), cd103 (pe), cd103 (fitc), cd105 (pe), cd117 (bv605), cd117 (apc), cd117 (percp-cy5.5), cd117 (pe-cy7), cd123 (pe), cd123 (apc), cd123 (r718), cd123 (bv786), articulatory tools (set of 4), jaw exerciser (set of 3), cd180 (pe), cd200 (apc), cd200 (apc-r700), cd200 (pe), cd278 (apc-h7), cd304 (apc-r700), igg kappa (fitc), igg kappa (pe), igg kappa (apc), igg lambda (fitc), igg lambda (pe), igg lambda (apc-h7), igd (fitc), igm (percp-cy5.5), mpo (fitc), mpo (pe), hla-dr (v 450), hla-dr (fitc), hla-dr (per cp-cy5.5)), hla-dr (apc), hla-dr (pe), tcr gd (bv605), tcr gd (pe-cy7), tcr gd (bv711), trbc1 (pe jovi 1clone)), fmc7 (fitc), fmc7 (v450), cxcr5/cd185 (alexa fluor 488), bcl2 (pe), ki67 (pe), bcl6 (pe), bcl6 ( per cp-cy5.5), bcl6 (alexa fluor647), cd64 (apc), cd64 (fitc), cd64 (apcr700), cd157 pe), cd15 (bv605), flaer (fitc), cd235a (fitc), cd59 (pe), cd86 (bv711), eosin-5 maleimide (ema), cd138 (apc), cd138 (v450), cd43 (bv605), cd99 (pe), tdt (apc), cd11b (fitc), cd86 ( apcr700), cd304 (apcr700), cd 278 (icos) apch7, cd 57 bv605, pdi (bv786), cd28 (apcr700), cd229 (bv786), bd falcon tubes 5ml round bottom tube with cap, bd facs flow sheath fluid 20l, bd facs bead (5 color), bd facs bead (7 color), bd facs bead (2 color), intrasure buffer, bulk lysis buffer, bd cs & t beads 12 color, bd facs lysing solution, bd facs permeabilizing solution, multiple myeloma minimal residual disease (mm-mrd)kit, stem cell enumeration kit, sterm cell controls

CTN :38477458 Due date: 27 Dec, 202427 Dec, 2024 NA
Tender For supply and installation of chemistry lab - analytical balance (03 digit analytical balance), analytical balance (04 digit analytica+b14:b135l balance), bench top non refrigerated centrifuge, table top conductivity meter, flash and fire point apparatus, electric melting point apparatus, electric oven (hot air oven), electric shaker 9 flask, heating mental 1000 ml with spare mental, heating mental 500ml with spare mental, hot plate cum magnetic stirrer, table top ph meter ( with electrodes ), digital calorimeter, potentiometer, refrigerator-280 liter laboratory type, redwood viscometer (type i & type ii) each, vacuum rotatory evaporator, vacuum pump mono block type, digital water bath, automatic polarimeter ric-74a, industrial furnace, double beam variable bandwidth uv-vis spectrophotometer, digital bomb calorimeter with computer and printer, boiling tubes, burrette with teflon stop cork 50 ml, burette with teflon stop cork 100 ml, burette with pinch cork 100 ml, buchner funnel (50 mm od), buchner funnel (65 mm od), buchner funnel (97 mm od), buchner funnel (156 mm od), capillary tubes, centrifuge tube, china dish 3, china dish 4, clear glass media bottle 50 ml, clear glass media bottle 100 ml, clear glass media bottle 150 ml, clear glass media bottle 250 ml, distillation apparatus, filter flask 1000 ml, filter, crucible, with sintered disc, conical flask-50 ml, conical flask-100cc, conical flask-250cc, conical flask-500cc with glass stop corks, conical flask-1000cc with glass stop corks, dropper, filtration flask 500 ml, glass funnels 50 mm, glass funnels 75 mm, glass funnels 100 mm, glass rod, graduated cylinder 10cc, graduated cylinder 25cc, graduated cylinder 100cc, graduated cylinder 250cc, graduated cylinder 1000cc, ignition tubes (single pack), ostwald viscometer, pestle & mortar 4", pestle mortar 5, petridishes -4inch, pipettes 10 ml bulb, pipettes 20 ml bulb, pipettes graduated 25 ml, pocket thermometer, pyknometers, reflux water condenser (30 cm), reflux water condenser (50 cm), still head plain, round bottomed flask (with single neck)100 ml with glass stop corks, round bottomed flask (with single neck) 250 ml with glass stop corks, round bottomed flask (with single neck) 500 ml with glass stop corks, round bottomed flask (with two neck)100 ml with glass stop corks, round bottomed flask (with three neck)100 ml with glass stop corks, separating funnel (250 ml), stalagmometer, suction pump glass, test tubes 25 ml (50 pcs box), thermometer 110 c, thermometer 360 c, tlc chamber, volumetric flask 100 cc with glass stop corks, volumetric flask 250cc with glass stop corks, beakers -100 ml plastic, beakers -250 ml plastic, beakers - 500 ml plastic, beakers-1 liter plastic, burette stand, crucible tongs 6, test tube stand 1.5 ml, desiccator 10 /250 mm dia, dustbin, flask stand, magnetic stirrer bar beads 5mm/15mm to 8mm/35mm, test tube stand plastic-25 ml, 3 ml plastic leak proof tube with cap, capillary tubes -heparinised (box), parafilm m roll, 250 length x 2" width, wash bottle, acetone (qualigens), acetic acid (qualigens), ammonia solution, benzene (cdh), benzaldehyde (qualigens), benedict reagent qualigens), buffer(ph=4, ph=7, ph=14), charcoal (qualigens), carbon tetrachloride (cdh), chloroform (qualigens), denatured ethyl alcohol/iso propyl alcohol (spirit for spirit lamp), dimethyl sulphoxide(qualigens), dimethyl formamide (qualigens), diethyl ether (qualigens), edta disodium salt (qualigens), ethyl alcohol (ethanol), glucose (qualigens), glycerine (qualigens), hydrochloric acid (qualigens), iodine crystal (qualigens), nitric acid (qualigens), petroleum ether (qualigens), paraffin liquid (qualigens), potassium dichromate (qualigens), potassium chloride (qualigens), potassium permanganate (qualigens), silica gel 60-120 mesh (for thin layer chromatography), silica gel 60-120 mesh (for column chromatography), sucrose (qualigens), sodium hydride (cdh), sodium chloride (qualigens), sodium metal (cdh), sodium nitroprus

State Government

CTN :38532452 Due date: 01 Jan, 202501 Jan, 2025 NA
Tender For supply of derma guard lite small,derma guard lite medium,derma guard lite large,last drop low retention pipette tips,last drop pipette tips,last drop low retention pipette tip,last drop low retention pipette tips,cr tubes_pp,micro centrifuges tube,micro centrifuges tube_pp,centrifuge tube conical bottom,cell spreaders gama radiated sterile,soft inoculation loop,polyvinyl pyrrolidone,2_mercaptoethanol,edta disodium dihydrate,phenol_chloroform,ethidium bromide,dreamtaq dna polymerase,3m sodium acetate solution,sodium chloride,isopropyl alcohol,magnesium chloride,bromophenol blue,glycerol,agarose le,10x taq buffer with kcl,dntp mix,generuler 1 kb plus dna ladder,ctab, molecular grade,tris base,acetone,indole_3_acetic acid,indole_3_butyric acid,1_naphthalene acetic acid,diphenylamine,tetrazolium salt,ammonium molybdate,ammonium fluoride,hydrochloric acid,potassium dichromate,stannous chloride,ferrous ammonium sulphate,sulfuric acid,orthophosphoric acid,sodium bicarbonate,diluent,isoamyl alcohol,gelatin,formaldehyde solutio

State Government

CTN :38532455 Due date: 01 Jan, 202501 Jan, 2025 NA
Tender For supply of acetone,agar powder,aluminium potassium sulphate dodecahydrate,ammonium fluoride,acetic acid glacial,ammonium persulphate,ammonia solution,brilliant green bile broth,diethylamine,ec broth,edta disodium salt dihydrate,n-_1-naphthyl_ethylenediamine dihydrochloride,hexamine,2-propanol,orthophosphoric acid abt,silver nitrate,stannous chloride dihydrate,spadns trisodium salt,silver sulphate,sulphanilamide,sodium azide,l-ascorbic acid,folin and ciocalteus phenol reagent,tannic acid,sodium carbonate anhydrous,2_2-diphenyl-1-picrylhydrazyl,quercetin dihydrate,gallic acid monohydrate,sodium bicarbonate,1-10-phenanthroline hydrochloride monohydrate,mercuric sulphate,2_3_5-triphenyltetrazolium chloride,sodium hexafluorosilicate,p-nitrophenyl phosphate disodium salt hexahydrate,dichloroisocyanuric acid sodium salt,antimony potassium tartrate trihydrate,cadmium chloride monohydrate,sulfuric acid pure,hydrogen peroxide,ammonium sulphate,ammonium molybdate tetrahydrate,ammonium ferrous sulphate hexahydrate,ammonium buffer s

Central Government / Public Sector

CTN :38274741 Due date: 18 Dec, 202418 Dec, 2024 6.65 Lacs
Tender For corrigendum : supply of grm 2 nos , ethanol anhydrous denatured ethanol 500 ml , glass beakers without sprout 2000ml , plastic tubs , glass jar 1000ml , syringe bottle 15 ml , brown tape big size , rubber band large tape , brushes for glass cleaning , labolene , uv sterilization chamber , khada cloth white , khada cloth black , camel hair brush , naphthalene balls , honey 500ml , liquid hand wash , groundnut , glassware cleaning brush , carboy bottle with stopcock , cavity dish , cover slips round , dropper plastic 3 ml , droppers pasture pipettes , food wrap rolls , forceps blent , forceps pointed , gada cloth white , genaxy contact plates , germination paper , glass beakers 500 ml , gps handy unit , ice tray , insect vials , loop holder , micro pipette variable , micro slides , milk powder , muslin cloth white , needle , nursery trays 40 wells , pasture pipettes , medium petri plate size 50x10mm , petri plate glass big size , polythene covers , sample container , small petri plate size 20x5mm , small tissue -culture conical flask , sorghum , test tube , tissue culture flask big size , tissue culture flask small size , tissue roll , towels , watch glass , zip-lock covers think size 15x10cn , honey dabur , corn floor , cover slip square , reagent bottles with screw caps 1liter , reagent bottles with screw caps 250ml , l shape spreaders disposable , absorbent cotton, 500gm , fungi tape , vitamin e capsules- 10 per sheet , multivitamin capsules 30 capsules in 1 bottle , vials 10ml , chloramphenical 5 gm each , rose bengal dye 25 mg , corn meal agar , sodium chloride , triton x 100 , chlorotetracycline , thiobendazaole , carbendazim , pentanitrochlorobenzene , benomyl , chloro tetracycline hydrochloride , turgital np-10 , tsm supplement 5 vails in 1 box , kings b media 500gm x 5 , maltose 500gm x 3 , peptone 500gm x 2 , tween 20 disinfectant , ethanol 500ml x 20 , sterillium 500ml , trichoderma harzianum selective agar base tsm media 500g x 5 , ph buffer solution 4.01 480ml x 2 , ph buffer solution 7.00 500 ml x 2 , formaldehyde 500ml x 5 , kings b broth 500g x 2 , potato dextrose broth 500g

Central Government And Public Sector

CTN :38532539 Due date: 01 Jan, 202501 Jan, 2025 NA
Tender For supply of rneasy plant mini kit 1x50,rnase free dnase set,filter tips 200ml,nuclease free water 10 x 50ml,dneasy plant mini kit 1x50,gelpilot dna loading dye 5 x 6 x 500ul,1m tris cl ph 8.2 500ml,0.5m edta solution ph 8.0 500ml,chloroform isoamyl alcohol 500ml,phenol chloroform isoamyl alcohol mixture 100ml,phenol solution equilibrated with 10mm tris hcl ph 8.0 with 1mm edta 100ml,6 x gel loading buffer 6x1ml,dntp mixture 1.28ml,takara ex taq 250 u

CTN :37724451 Due date: 18 Dec, 202418 Dec, 2024 NA
Tender For corrigendum : supply of ammonia buffer solution (q3) , bovine albumine (q3) , sodium arsenite (q3) , sodium azide (q3) , sodium bicarbonate (q3) , starch as per is 1005 (q4) , di sodium hydrogen phosphate-is:567 (q3) , ferric chloride anhydrous (q3)
 Loading, Please wait...

Connect us via What's Up