Web Analytics Made Easy - StatCounter

Chemical Spray Tenders

Get complete information related to latest Chemical Spray Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Chemical Spray Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Chemical Spray Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

corporations/Associations/Others

CTN :40033983 Due date: 24 Apr, 202524 Apr, 2025 4.70 Lacs
Tender For procurement of chemical, media ingredients and other miscellaneous items for water quality monitoring unit, vinay marg, chanakya puri - supply of following chemicals, glassware, media ingredients and other miscellaneous items for water quality monitoring unit, vinay marg, chanakya puri.acetone (500 ml), ammonia solution (500 ml), iso amyl alcohal (100 ml), ammonium chloride (500 gm), ammonium purpurate (5 gm), bile salt (500 gm), bgb broth(dehydrated) (500 gm), bromocresol green indicator soln. (125 ml), calcium chloride(fused) (500 gm), cobaltus chloride(fused) (500 gm), edta n/50 solution (500 ml), hydrochloride acid (500 ml), lactose (500 ml), mackonky broth,dehydrated (500 ml), methyl orange indicator soln (125 ml), methyl red indicator soln (125 ml), neutral red (25 gm), nitric acid (500 ml), neutrient agar (500 gm), peptone (500 gm), phenolphthalein indicator soln. (125 ml), ph indicator paper 2-10.5 ph (pack), potassium chloroplatinate (01 gm), potassium chloromate (500 gm), potassium iodide (500 gm), potassium permanganate ar (500 gm), silica gel cc/tlc/blue self indicating (500 gm), silver nitrate n/50 sol. (500 ml), sodium chloride (500 gm), sodium thiosulphate (500 gm), sulphuric acid (500 ml), beaker borosil (250 ml), gooch crucible ,borosil(50 ml cap.), burrett(50 ml)

Central Government/Public Sector

CTN :40033398 Due date: 08 May, 202508 May, 2025 NA
Tender For supply of media chemicals and antibiotics for dept of micro biology at aiims bhopal - rare disease medicine, aesculin, agar agar powder, bacterioides bile esculin agar base, bird seed agar, blood agar base no.2, bovine serum albumin (bsa), brain heart infusion agar base, brain heart infusion broth base dehydrated, brucella agar base with hemin & vitamin k1, canavanine glycine bromothymol blue agar/cryptococcus differential agar dehydrated, chrom agar for isolation and identification of candida species., citrate agar, simmons, cled agar dehydrated, corn meal agar dehydrated, crome agar cromogenic group b streptococcus selective agar base, czapekdox agar dehydrated, dermatophyte test medium agar base dehydrated, dichloran rose bengal chloramphenicol yeast extract sucrose agar dehydrated, egg yolk agar base, hichrom agar m1297a, indole nitrate broth base, macconkey agar w/o cv, macconkey broth double strength dehydrated, malt extract agar dehydrated (meat), mannitol salt agar dehydrated, manniton motility test medium, moeller decarboxylase broth base, mueller hinton agar dehydrated, mueller hinton broth, cation adjusted, nitrate broth dehydrated, nutrient agar, oatmeal agar, potato dextose agar, propionibacter isolation agar, pyr agar, robertson cooked meat medium rcm, rpmi 1640 with glutamine & without sodium bicarbonate, w/o phenol red, sabourauds dextrose agar/sabourauds dextrose agar emmons modification dehydrated, sabourauds dextrose broth dehydrated, selenite f broth, sheep blood, sucrose powder, todd hewitt broth, tri sodium citrate, trihalose powder, triple sugar iron agar (tsi) dehydrated, tryptone soya agar, tryptone type 1, urea 40% supplement, yeast extract powder, yeast one broth (10x11ml), -naphthylamine readymade solution, acetic acid aldehyde free (acetone), acetone, agarose powder (molecular grade), aluminium ammonium sulfate, ammonia solution, andrades indicattor (1001), anerobic catalyst low tempreture (a00010 x 5), antisera for salmonella vi, aqueous solution of picric acid (saturated), autoclave indicator tape steam, b. fragilis atcc 25285, bacteroides selective supplement fd062-5vl, basic fuchsin, biological indicator for autoclave (la926-1x50no) geobacillus stearothermophilus scbis", biological indicatore hot air oven bacills atrophascus, bromothymol blue, buffer capsule ph 4.0, buffer capsule ph 7.0, buffer capsule ph 9.2, calcium chloride anhydrous, calcofluor white (liquid stain ready to use approx 100 ml), capreomycin sulfate cat. sigma c4142, carbol fuchsin, cc selective supplement fd010-5vl, citric acid, coagulase plasma, crystal violet, d- (+) glucose anhydrous, d-(-)-salicin, d-mannitol (mannitol sugar disc), demineralized water, di-potassium hydrogen phosphate anhydrous, diethyl ether ar grade, dmaca reagent (pyr reagent), dmso, dna ladder (100bp), dpx mountant, dulcitol sugar disk, egg yolk infusion, ethanol absolute (analytical grade), ferric ammonium sulphate, formaldehyde (40%), formalin solution, galactose sugar disk, galactose sugar powder, gas pack le0028-5no (anaero gas pack) 5x1nos, gelatin, giemsa powder, glacial acetic acid, glassware cleaning reagent, glucose sugar disk, glycerol (anhydrous emplura), hand rub / sanitizer, hand wash liquid soap, hematoxylin powder, hydrochloric acid (conc.), hydrogen peroxide 30% h2o2, hypochlorite (5%) / sodium hypochlorite 5%, immersion oil, india ink/nigrosine, inositol sugar disk, iodine crystals, iodine gram stain (gram iodine), kovacs indole reagent (indole : p-dimethyl benzaldehyde), l- arginine, l- ornithine hcl broth m688, l+ arabinose, lactophenol cotton blue (approx 100 ml) ready to use, lactose sugar, lycine hcl broth, lysol, magnesium sulphate anhydrous, malachite green, maltose, mannitol sugar powder, mcfarland standard set, methanol purified ar grade (hi-lr), methylene blue, modified zn stain, n-acetyl-l-cysteine, neutral red dye (indicator), neutral red powder, normal saline plain, nuclease free water, oleic acid, paraffin sterile

State Government

CTN :40035923 Due date: 22 Apr, 202522 Apr, 2025 NA
Tender For etender for supply of lab material at ggsmch faridkot - lab material, andreads indicator 1 bottle=125 ml, sulphuric acid (conc) 1 bottle-500 ml, sodium selenite hydrogen 1box=500gm, aztreonam 30ug 1 vial=100 discs, n acetyl l cysteine (nalc) 1box= 100gm, imipenem-relebactam 10/25ug 1 vial=100 discs, g6 phosphate powder 1box=1gm, dna extraction teaching kit, rna teaching kit, electrophoresis teaching kit, pcr teaching kit, conc. h no 3, conc. h2 so4, orthophosphotungstic acid, disodium phenyl phosphate, conc.hcl, liquor ammonia, ferrous chloride, spirit flameable, ph strips pack 1x1 pc strips, bile salts 1box=500gm, xld agar 1box=500gm, tcbs agar 1box=500gm, petridish disposable 90 15 mm individually packed, sterile, per pack (450-500 pc), lysol -500ml per bottle = 500 ml, micro glass slides size 75mm 25mm with thickness of 1.35 mm made from english glass. pack of 50 slides, lactose 1box=500gm, tryptone 1 box=500gm, kovac s indole reagent 1 bottle=100 ml, ampicillin 10 g /disc 01 vial= 100 discs, erythromycin 15 g/disc 01 vial= 100 discs, cefoxitin 30 g/disc 01 vial= 100 discs, cefoperazone 75 g/disc 01 vial= 100 discs, cefotaxime 30 g/disc 01 vial= 100 discs, ceftazidime 30 g/disc 01 vial= 100 discs, cefepime 30 g/disc 01 vial= 100 discs, cefixime 5 g/disc 01 vial= 100 discs, nalidixic acid 30 g/disc 01 vial= 100 discs, norfloxacin 10 g/disc 01 vial= 100 discs, ofloxacin 5 g/disc 01 vial= 100 discs, gatifloxacin 5 g/disc 01 vial= 100 discs, ciprofloxacin 5 g/disc 01 vial= 100 discs, amoxycilin & clavulanic acid 20/10 g/disc 01 vial= 100 discs, piperacillin & tazobactum 100/10 g/disc 01 vial= 100 discs, vancomycin 30 g/disc 01 vial= 100 discs, linezolid 30 g/disc 01 vial= 100 discs, clindamycin 2 g/disc 01 vial= 100 discs, colistin 10 g/disc 01 vial= 100 discs, polymyxin-b 300 units 01 vial= 100 discs, amikacin 30 g /disc 01 vial= 100 discs, imipenem 10 g /disc 01 vial= 100 discs, meropenem 10 g /disc 01 vial= 100 discs, ceftriaxone 30 g /disc 01 vial= 100 discs, nitrofurantion 300 g /disc 01 vial= 100 discs, netillimycin 30 g /disc 01 vial= 100 discs, cefoperazone +sulbactum 01 vial= 100 discs, tetracycline 30 g /disc 01 vial= 100 discs, cotrimoxazole 25 g /disc 01 vial= 100 discs, ceftazidime +clavulinic acid 30 g /10 g 01 vial= 100 discs, cefotaxime + clavulinic acid 30 g /10 g 01 vial= 100 discs, gentamicin 30 g 01 vial= 100 discs, azithromycin (sd204) 15 ug 01 vial= 100 discs, high level gentamicin 120 g 01 vial= 100 discs, novobiocin 5 g 01 vial= 100 discs, ertapnem 10ug 01 vial= 100 discs, insulin syringe 1 ml, individually packed, sterile,disposable 01 pkt= 10 syringes, fosfomycin 200ug 01 vial= 100 discs, oxidase disc 01 vial= 100 discs, mr-vp broth 1 box=500gm, ra factor(latex agglutination) 1 kit= 50 test, absolute ethanol 1 bottle =500 ml, basic fuschin 1 bottle =25 gm, racked graduated filter tips sterile 1250 ul xl dnase rnase pyrogen free 1 box=96 tips, cresol red 1box=5 gm, crystal violet 1box=25 gm, albert stain 1 box= stain a and b, bromothymol blue 1box=5gm, neutral red 1box=5gm, racked graduated filter tips sterile1000 ul dnase rnase pyrogen free 1 box=96 tips, racked graduated filter tips sterile 200 ul dnase rnase pyrogen free 1 box=96 tips, racked graduated filter tips sterile 2-20ul(long tip)dnase rnase pyrogen free 1 box=96 tips, racked graduated filter tips sterile 0.5-10ul(long tip)dnase rnase pyrogen free 1 box=96 tips, syringes 2ml disposable 1 box=100 syringes, chrom agar for candida 1 box =100gm, nichrome wire with loop holder(.004ml) 1 pc, spirit burning 1 bottle =1ltr, falcon tube 15ml(conical bottom)sterile,autoclavable 1packet=50 tubes, falcon tube 50ml(conical bottom)sterile,autoclavable 1packet=20 tubes, actidione (cycloheximide) 1 pack =1gm, urea agar base (christensen) 1 box =500gm, urea analytical reagent 1 box =500gm, syringes 5ml disposable 1 box=100 syringes, tuberculin syringe 1 ml, individually packed, sterile,disposable 1box=100 syringes, tuberculin ppd ip 5 tu/0.1ml for man

CTN :39870162 Due date: 25 Apr, 202525 Apr, 2025 NA
Tender For corrigendum : procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liq

CTN :39986629 Due date: 30 Apr, 202530 Apr, 2025 64.67 Lacs
Tender For providing for supply of 07 vehicles - hiring of tractor and trolley with driver plough exfoliator including fol , hiring of jcb including with driver and fol , hiring of bush grass cutting machines , hiring of tree pruning machines petrol including fuel and lubricant , hiring of hygiene chemical spray machines , chemical for spray machines

State Government

CTN :39967336 Due date: 06 May, 202506 May, 2025 387
Tender For supply of chemicals and glass wares to the mmc and ri and its associated hospitals. - cefuroxime 30mg 5x100discs, ceftriaxone 30mg 5x100discs, cefoxitin 30mg 5x100discs, cefotaxime 30mg 5x100discs, cefazolin 30 mg 5x100 discs, cefepime 30mg 5x100discs, aztreonam 30mg 5x100discs, azithromycin 15mg 5x100discs, amoxicillin-clavulanic acid 20/10mg5x100discs, ampicilin sulbactam, ampicilin 10mg 5x100discs, amikacin 30mg 5x100discs, meropenem vaborbactam 20/10mg 5x100discs, imipenem relebactam 10/25 mg 5x100discs, moxiflaxacin 5mg 5x100discs, minocyclin 30mg 5x100discs, meropenem 10mg 5x100discs, imipenem 10mg 5x100discs, levoflaxacin 5mg 5x100discs, linezolid 30mg 5x100discs, high level gentamicin 120mg 5x100discs, lefamulin 20mg 5x100discs, gentamicin 10mg 5x100discs, fosfomycin 200mg 5x100discs, erythromycin 15mg 5x100discs, ertapenem 10mg 5x100discs, doxycycline 30mg 5x100discs, colistin (pure drug) 10mg 5x100discs, tedizolid 30mg 5x100discs, ceftarolin 30mg 5x100discs, ceftazidime-avibactum 30/20mg 5x100discs, cefiderocol 30mg 5x100discs, co-trimoxazole 1.25/23.75mg 5x100discs, ceftazidime 30mg 5x100discs, clindamycin 2mg 5x100discs, cipro flaxacin 5mg 5x100discs, cefotetan 30mg 5x100discs, brewel thioglycholate medium 500gm, peptone (bacteriological) 500gm, agarpowder(bacteriological) 500gm, macconkeyagar 500gm, mueller hinton agar 500gm, nutrientagar 500gm, disodium edta 125ml, cefatazidime clavulonate 30.oct 100discs/box, tobramycin 10mg 100discs/box, cefotetan 30mg 100discs/box, rifampicin (rif) 15mg 5x100discs, colistir e strips 0.016-256 mg/ml 10x100strips, vancomyan e strips 0.016-256 mg/ml 10x100strips, ceftotomane-tazobactam 30/10mg 5x100discs, imipcnem-relebactam 10/25mg 5x100discs, plazomicin 30mg 5x100discs, vancomycin 30mg 5x100discs, cefpodoxime 10 mg 5x100discs, tetracyclin 30mg 5x100discs, stretomycin 300 gm 5x100discs, sulbactam durlobactam 10/10 mg 5x100discs, piperacillin tazobactum 100/10mg 5x100discs, pencilin 10mg 5x100discs, nitrofurantoin 300mg 5x100discs, ceftolozane tazobactum 30/10 mg 5x100discs, cary blair medium 100gm, sodium deoxycholate 100gm, sodium taurocholate 500gm, tetrathionate broth base 100gm, tcbs 500gm, bird seed agar 100gm, deoxycholate citrate agar 100gm, moeller decorboxylase broth (ornithine) 250gm, moeller decorboxylase broth (lysine) 250gm, moeller decorboxylase broth (arginine) 250gm, lysine iron agar 250gm, bismuth sulphate agr 500gm, wilson and blair agar base 500gm, corn meal agar 500gm, bile esculin agar 500gm, dnase agar base 100gm, cled with bromothymol blue indicator 500gm, xylose lysine deoxycholate agar 500gm, tripticase soya broth 500gm, r2a agar 500gm, simon citrate agar base 500gm, christensen urea agar base 500gm, triple sugar iron agar 500gm, beef extract 500gm, brain heart infussionbroth (bhi) 500gm, sucrose 500gm, mannitol 25gm, actidione (cycloximide) 10gm, tetramethyl 4 phenylene iaminedihydrochloride 100gm, amylal cohol (isoamylalcohol) 1000ml, dimethyl aminobenzaldehyde pure (paradimethyl) 100ml, indole reagent 500ml, pottasium iodide 500gm, pottasium hydroxide 100gm 500gm, basicfucshin powder 500gm, phosphate powder 100gm, alberts stain (a&b) 125mleach, methylene blue 500ml, grams iodine 5gm 125ml, diethyl ether 500ml, zinc sulphate 25gm, lead acetate 25gm, glucose 500gm, lactose 500gm, raffinose 25gm, dulcitol 25gm, maltose 100gm, sorbitol 500gm, arabinose 25gm, mannose 500gm, glacial acitic acid 500ml , andrades indicator 500ml , robertsons cooked meat medium 500gm , sabouraud dextrose agar 500gm , mannitol salt agar 500gm , sodium chloride 500gm , inoculation loops with holder (change able loop) 1x24no/pack, metal loop holder 1x24no/pack, force psplain pointed 10inch, test tubes with rim 15x150mm, test tubes with rim 15x125mm, test tubes with rim 12x100mm, beakers 500ml 100ml, beakers 250ml, lense cleaning paper 10pkts/box, teasing needles 72pcs, cryo vials 2ml, autoclavable plastic petridishes 90mm, mac cartney (bhi bottles) 25 mlof 36 bottle/ pack, du

State Government

CTN :39919589 Due date: 19 Apr, 202519 Apr, 2025 NA
Tender For lab kits consumables and other items for rajindra hospital patiala - paper roll, pti kt, g6pd kits, methanol 2.5ltrs bottles, leishman stain powder (bottel), 10% sodium hypchlorite (liters), liquid paraphin (bottels), retic stain (bottels-125 ml), spirit (liters), test tubes, micro capillary tubes (box ), slides (box), westergren pipttes, edta vaccutainers, plain vaccutainer, sodium flouride, pti vaccutainer, esr vaccutainer, urine containers, syringe (20ml), syringe (10ml), syringe (5ml), syringe (2ml), disp.gloves( 7.5), disp.gloves( 7.00), disp.gloves( 6.5), cotton (bundles), bone marrow needle (no.14, bone marrow needle (no.16, bone marrow needle (no.18, jamshidi needle, lignocane 2% 30ml (bottels), micropore (pc), betadine (bottles), urine strips (box), nitrile gloves (box), blotting sheet 2 bundles (1000 sheets ) boxes, cover slip boxes, gentamicin 120mg hlg (vials), ceftazidime + clavulanic acid (30mg+15mg) (vials), ciprofloxacin (30 mg) (vials), ceftriaxone (30 mg)(vials), teicoplanin (30mg) (vials), azithromycin (30mg) (vials), cefoperazone + sulbactam (30 mg+15mg) (vials), nutrient agar (500 gms) boxes, potato dextrose agar (100 gms) boxes, nutrient gelatin (100gms) boxes, of basal media (100 gms) boxes, nitrate broth (100gms) boxes, cled agar with andrade s indicator (500gms) boxes, corn meal agar (500 gms) boxes, hi chrome candida differential agar (100gms) boxes, dextrose (500gms) boxes, sucrose (500gms) boxes, mannitol (500gms) boxes, lactose (500gms) boxes, acetone (litre x 5), lead acetate (500 gm), acid carbolic (500 gm), acid sulphuric (2.5l ), acid acetic, disodium hydrogen phosphate (500 gm), ferric chloride ar (500 gm), glycerine (500 gm), toluidine (gm), i- phenylalanine (500 gm), neutral red (125 gm), acid fuchsin ( 25 gm), basic fuchsin (25gm), potassium tellurite (25gm), sodium taurocholate (500 gm), sodium hydroxide (500 gm), di potassium hydrogen orthophosphate (500 gm), methyl red reagent (100ml), andrade s indicator (100ml), alpha napthylamine (500gm), potassium iodide (100gm), sulphanillic acid 0.8% (100 ml), n, n, n ,n- tetramethyl-p-phenylenediamine dihydrochloride (5g), potassium hydroxide (500gm), widal test kit 4x5ml (to,th,ah,bh) (kits ), crp latex slide agglutination kit (50 tests), ra latex slide agglutination kit (50 tests), aso latex slide agglutination kit (50 tests, ppd 5 tu/ 0.1 ml & 10 tu/0.1 ml (vial), upt strip test, toxoplasma strip test, rpr strip test, hav rapid card, hev rapid card, hep b core antibody igm and igg elisa, rubella igm elisa, cmv igg elisa, hsv-1&2 igm - elisa, petri dish 3 (pc), petri dish 4 (pc), petri dish 4"disposable (pc), durhams tube, over slips (20 boxes (400 packets), blood culture bottles (50ml) 1367019 (bottles), blood culture bottles (160ml) 1367019 (bottles), whatman filter paper rim, filter paper rim (ordinary) (rim), gloves (pair), masks (disposable ), heating elements (autoclave) (elements), insulin syringes, t3 (96 wells), t4 (96 wells), tsh (96 wells), vitamin d 3 (96 wells), lh (96 wells), fsh (96wells), prolactin (96 wells), testosterone (96 wells), psa (96 wells), ca-125 (96 wells), cea (96 wells), ca-15.3 (96wells), alpha fetoprotein (afp) (96wells), ca-19.9 (96 wells), ferritin (96wells), insulin (96 wells, beta hcg (96 wells), amylase, cpk-mb (20x1.1 ml), ldh (20x1.1 ml), cpk total(ck-nac) (15x1.1 ml), phosphorous (2x50 ml), calcium (2x50 ml), micro protein kits for csf (1x50 ml), blood urea kit (2x1 litre), uric acid (4x50 ml), cholestrol 5x20ml, triglycerides 5x20ml, sgot 5x20, sgpt 5x20, alp 5x20 ml, glucose 2x200 ml, total bilirubin 4x50 ml, ammonium sulphate 500gm/(ar) ( packs), disodium phenyl phosphate 100gm per pack (ar) ( packs), trichloracetic acid (tca) ar 500gm ( packs), methanol (ar) 2.5 ltr per pack ( packs), trisodium citrate (ar) 500gm per apck ( packs), methylated sprit (ar) 5lrt per apck ( packs), sodium dihydrogen phosphate (nah2po4) (ar) ( packs), sulphur powder ar 500gm per pack ( packs), liquor ammonia ar 250 m

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39714830 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For supply of 2025-26 (ami no. 33.1.11) c.l.e.d agar (cysteine-lactose-electrolyte-deficient agar) w ith bromthymol blue, dehydrated culture medium, 500 gms per pack ]
 Loading, Please wait...

Connect us via What's Up