Latest dichloromethane Tenders | Government dichloromethane Tenders

CTN :39939011

01 May, 2025 46.75 Lacs

Rohtak - Haryana

Tender For rate contract for two years (extendable for another one year or till fresh r/c is finanlized whichever is earlier) for the purchase of raw material orthopaedics workshop - - pvc granules 0.40 (led) (bag of 25 kg.) , synthetic fevicol rubber adhesive s.r.998 (tin of 5 ltr.) , rubber sheet nir (3'x4') , rexene (superior) , aluminum sheet 20 gauge (4'x8') , p.o.p. powder (25 kg. bag) , (j.k lakshmi, j.k super lakshmi, aggarwal gypsum plaster) , hexa blade (10 blade per pkt.) , plastic karhi 1" pkt. of 100 pieces , plastic karhi 1" pkt, of 100 pieces , plastic karhi 2" pkt. of 100 pieces , t.p. thinner (pack of 5 ltr. murga brand) , thinner , velcro 1" (m+f) roll of 25 mtr. psi 7.5-8.0 life cycle 250-350 , velcro 1" (m+f) roll of 25 mtr. psi 7.5-8.0 life cycle 250-350 velcro 2" (m+f) roll of 25 mtr. psi 7.5-8.0 life cycle 250-350 , nylon thread black for sewing machine (1500 mtr. per reel) , elastic 1" roll of 25 mtr. , elastic 2" roll of 25 mtr. , jigshaw blade (5 blade per pkt.) , machine oil , bifurcate rivet " round head (pkt. of 500 pcs.) , bifurcate rivet 1" round head (pkt. of 500 pcs.) , w-buckle " (iron) (1 kg. per pkt.) , d buckle " (iron) (1 kg. per pkt.) , d buckle 1" (iron) (1 kg. per pkt.) , niwar nylon 1" (roll of 1kg) , niwar nylon 1" (roll of 1.5 kg.) , niwar nylon 2" (roll of 2 kg) , raising sheet %" (1mtr. x 2 mtr.) , raising sheet 1" (1mtr. x 2 mtr.) , raising sheet 1.5" (1mtr. x 2 mtr.) , t.p. sheet 2.2 mm , cotton stockinet 2" , cotton stockinet 3' , cotton stockinet 4" , cotton stockinet 5" , cotton stockinet 6" , sole leather (med.) madrasi , calf leather (black superior) , chrome leather (black superior) , smash leather (swede) , goat skin superior , poly propylene sheet 1 mm 3'x6' , poly propylene sheet 1.5 mm 3'x6' , plastnova sheet 3 mm 3'x6' (ortho pc) , plastnova sheet 4 mm 3'x6' (ortho pc) , plastnova sheet 5 mm 3'x6' (ortho pc) , sponge sheet " 4"x8", knee joise forged small size , knee joint forged med. size , knee joint forged large size , pigment pao c??????? , pvc fit 0.5 micron , polyester resin (10 kg. por can) , accelerator for polyester resin , catalyst for polyester resin , fiber glass for polyester vasin (10 kg. per roll) , below elbow kit left/righer (alimco) , ranger foot 20 cm (rt & lt) with 5.5. nut & bolt (90x10mm with ln head) , ranger foot 22 cm (kt & lt) with 5.5. nut & bolt (90x10mm with ln head) , ranger fon 23 cm (rt & lt) with 55. nut & bolt (90x10mm with ln head) , ranger foot 24 cm (rt & lt) with 5.5. nat & bolt (90x10mm with ln head) , ranger foot 25 cm (rt & lt) with s.s. nut & boit (90x11man with ln head) , ranger foot 26 cm (rt & lt) with s.s. nut & bolt (90x10mm with lm head , ranger foot 27 cm (rt & lt) with ss. nut & bolt (90x10mm with ln head) , ranger fout 28 cm (rt & lt) with 5.5. nut & bolt (90x10mm with ln head) , cloth (khadi cotton) colored , camvas cleth , two way highly stretchable synthetic cloth for stockinga , four way highly stretchable synthetic eloth for stockings , shoe cloth , press dutton whine 12mm (plz. of 1000 pa , bolt with nut 5/32"x1" (flat head) , bolt with nut 1/32x3/4" (head) , bolt with nut /16"x1/2" , bolt with nut 10x6 , bolt with nut 3/16 x , bolt with nut 5/32" x 1.5" (5.5) , bolt with net 4"x1" (half round head) wooden screw full thread star head 14" (250 pcs. per plat) , wooden screw full therad star head 1" (250 pcs per pkt.) , wooden screw full thread star head 1/4" (250 pos. per pet) , iron washer 4 mm hole, 12 dianeer , iron washer w" hole 1 diameter (heavy) , copper rivet 1/8"x1/2" , copper rivet 5/321/2" , copper rivet 1/16"x1/2" , copper rivet 1/3/4" , copper rivet 3/32"x3/4" , capper rivet 3/16"x3/4" , it rivet 5/32" 3/4" (flat hend) , iron rivet 3/32" x 1/4" 10 no. (plat head pkt of 2.5 kg) , ron strip 1/16 soff , fron strip 1/8"x1" , strip 1/16"x1" , irus strip 5/32% n , iron strip 1/8 , iron strip 1/16x 1" , nail 13 mm , nail mm , iron keel 1" , sole polish blac

CTN :39986331

02 May, 2025 NA

Balasore - Odisha

Tender For supply of cap , cook apron , handwash liquid , rubber gloves , washing powder , cloth whitener , cotton cloth , barber apron , large scissor , small scissor , talcum powder , shaving blade , , large comb , hair cutting spray , sewing machine oil , needle , thread , lylon thread , black shoe polish , small hand towel , toilet brush , soft broom , phenyl , black phenyl , coconut broom , detergent cake , shaving cream , shaving lotion , cloth scissor , boot polish brush , adhesive solution , hand brush , air refresher , moping cloth , napthalene ball , hand towel , washing brush , wiper , anti septic liquid , nail , hair dusting brush , dusting cloth , detergent powder , knife

State Government

CTN :39932472

19 Apr, 2025 3.50 Lacs

Dhar - Madhya Pradesh

Tender For supply of iti items - basic electrical er. book scvt, work shop calulation & science electrical book scvt, work shop calulation & science mechenical book scvt, basic er. drwaing electrical book, basic er. drwaing mecheical book, employer ability skill book, carpainter trade theory book, wire man trade theory book, tracter mechenic trade theory book, fan regulator, aluminum wire 6mm isi mark, aluminum wire 8 mm isi mark, pander holder, casin patti pvc 1 inch, casin patti pvc 1.5 inch, copper wire isi mark celeve insulation, warnish, cotton tap, cilive no. 1 to 7, steel screw 16 by 4, wood polish warnish, copper wire 1.5 mm, copper wire 2.5mm, flaxible wire 25/36, soldring wire, soldring flux, tap isi mark, cotton weste, engine oil crb, drill machine chakkra 5 inch sut with key, lawan remover bush cutter machine carben brush, grinder wheel ( smoth wheel ), oil filter isi mark, disel filter, touch wood polish, wiper, plastic grip, polish, brush kalam, butten holder, fan regulator resistance, bell push switch, ciling rose, angle holder, water colour camel, bombay kill(nail)3 inch, biranji 3 by 4 inch, drill burma, keel 1 inch 2 inch 3 inch, fevicol, sent paper rezmal 0 to 60 no., roll paper 80 no isi, laboratry ovum ilament 500 watt, drill machine 13mm armecher carbon brush, lakdi beat 6 mm to 12 mm, grinder patte 36 40 60 80 no., grinder dick, cutter machine patta 5 inch, grinder patte loha ghisne ka, circuler saw machine cutter 08 inch, circuler saw machine rande ki blade 13 inch, ply 18 mm 4 by 8 isi, ply 12 mm 4 by 8 isi, pipe 2 inch 20 feet long, angle 2 inch 10 ft long, door mate, thinner, prakar, drawing copy, practical copy, cane chair, jangal lakadi satkata babul neem etc, sanmica 4x8, fan bearing 6201/6202, pvc paper 5, 7 no, fan condenser 2.5 mfd, welding electrodes size 2.90 by 3.50mm, tractor fuel pipe line all size, v belt machine all size, nut bolt all size, machin screw all size, half treat steel screw all size

CTN :39964794

30 Apr, 2025 NA

Sultanpur - Uttar Pradesh

Tender For supply of paint remover / stripper chemical, dichloromethane based (weight% -60-85) (item code 1000370124)

Central Government/Public Sector

CTN :39897831

23 Apr, 2025 NA

Kottayam - Kerala

Tender For supply of solvents - hexane takara , acetonitrile sigma , toluene sigma , dichloromethane 1 , dichloromethane 2

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Dichloromethane Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector