Latest dna polymerase Tenders | Government dna polymerase Tenders

CTN :42413947

01 Nov, 2025 1.00 Lacs

Hazaribag - Jharkhand

Tender For supply of gypsy oil filter,gypsy air filter,gypsy fuel filter,gypsy body repair,gypsy half body paint,gypsy l h windshield with motor,gypsy gear oil,gypsy engine oil,gypsy transmission oil,gypsy coolant 2.5l,gypsy brake fluid,gypsy seat cover,gypsy wheel bearing,gypsy brake shoe,gypsy fuel pump,gypsy radiator,bike engine oil,bike air filter,bike brake shoe,bike km wire

corporations/Associations/Others

CTN :42413650

07 Nov, 2025 NA

Multi City - Multi State

Tender For auction sale of 100mt emulsion tank 1,new truck chasis with body & cabin,goods transportation truck (eicher make,thermic fluid heater tp-06,70 kl emulsion tank -203,70 mt emulsion tank -204,1 x 50kl water tank,fire water pump - m&p,elder drum filling machine

CTN :42331658

30 Oct, 2025 2.65 Lacs

Srinagar - Jammu And Kashmir

Tender For supply of aviary body fat analyser ultrasonic digital bmi and body fat scale 200 kg bmi weighing scale , abco 2050x610x850 mm mild steel stretcher trolley , hospital wheel stretcher 6x2x3 ft life care medical equipment and services , medsun healthcare scoop stretcher aluminum , lupin nebster mesh nebulizer 45x125x70 mm , dr trust usa model 210 finger tip oxy meter , dr trust smart automatic digital blood pressure moniter bp machine 101 black , bull nose oxygen regulator with humidifier bott and spanner for b and d type cylinder , electric blankets for patients , dr trust usa waterproof flexible tip digital thermometer while model 604 , dr vaku digital infrared human body thermometer , karft hospital bed one function manual with foam mattress , iv fluid warmer cabinet premier tech , mdk med 12 pt 1 inch multipara patient monitor

CTN :42313106

23 Oct, 2025 6.22 Lacs

Pune - Maharashtra

Tender For 1. string sleeves tip combs, 10/pack 2. 96 well deep well plates, 10/pack 3. magnxt tissue and body fluid dna extraction kit 250 rxn

Central Government And Public Sector

CTN :42386004

23 Oct, 2025 NA

Pune - Maharashtra

Tender For procurement of products string sleeves tip combs, 10/pack ,96 well deep well plates, 10/pack ,magnxt tissue and body fluid dna extraction kit 250 rxn

Central Government/Public Sector

CTN :42283512

04 Nov, 2025 NA

Hazaribag - Jharkhand

Tender For supply of 100 bp dna ladder dye plus , 50 bp dna ladder dye plus , 10bp dna ladder dye plus , rnase a 50 mg , proteinase k 100 mg , tris acetate edta buffer tae 50x powder ph8 3 , tris borate edta buffer tbe powder ph8 3 , tris edta buffer te 10x powder ph7 4 , 6x loading dye , rnase free water 1000 ml , dna off dna destroys agent surfac clining , ethidium bromide , tween 20 , edta disodium salt , edta , sodium dodecyl sulfate sds , phenol , ethanol mb grade , mercaptoethanol , polyvinylpyrrolidone pvp , chloroform ar acs grade , sodium acetate , sulphuric acid ar acs grade assay min 98 pack of 2 5 ltr in glass bottle nabl iso iec 17025 2017 certificate required , nitric acid ar acs grade assay 68 70 pack of 2500 ml in glass bottle nabl iso iec 17025 2017 certificate required , ammonium molbdate ar grade assay min 99 pack of 250 g , dimethyl sulphoxide dmso ar grade 99 pack of 500ml , tris buffer ar acs 99 9 pack of 500g , tris hydrochloride tris hcl assay 99 pack of 500g , sodium chloride acs grade assay 99 9 pack of 500g , perchloric acid 70 ar acs grade assay min 70 pack of 500 ml in glass bottle nabl iso iec 17025 2017 certificate required , agarose molecular biology grade white to off white powder moisture content 8 gel strength g cm2 1200 min dnase rnase protease none detected pack of 500g , cetyltrimethyl ammonium bromide ctab assay 99 pack of 500 g , phenol chloroform isoamyl alcohol 25 24 1 ph 8 0 , fe hedta n 2 hydroxyethyl ethylenediaminetriacetic acid extrapure 99 iron fe content 12 14 pack of 500 g , isopropanol acs grade assay 99 5 pack of 1 ltr , tris saturated phenol ph 8 mb grade dnase rnase protease not detect pack of 100ml , pcr grade extrapure mgcl2 25 mm pack of 10 ml , taq dna polymerase 10x buffer with mgcl2 5u ul 5000u the polymerase is supplied with separate tubes of buffer mg2 plus and dntps pack of 250ulx20 , tris buffer ar acs for molecular biology 99 9 assay 99 9 pack of 1kg , sodium hydroxide naoh acs grade , dithiothreitol dtt if working with protein sensitive dna extractions

Central Government/Public Sector

CTN :42291516

04 Nov, 2025 NA

Bhimtal - Uttarakhand

Tender For supply of solution 100mm , mem non essential amino acids solution 100x , 1n hydrochloric acid solution sterile filtered 10 x 20 ml , parafilm m sealing film 100mm 38mtr dimension mm 132x135x112 , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 22um 25mm diamtere with prefilter sterile , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 45um 25mm diamtere with prefilter sterile , sterifast in 500ml dispenser bottle w pump , hishield hand wash in 1 lit can pack , germitol 5 lit can pack , steriswift disinfectant wipes size 6x8 , glycerol 1 2 3 propanetriol for molecular biology , calcium chloride anhydrous cell culture tested , luria bertani agar miller , tryptone soya agar casein soyabean digest agar , tryptone soya broth soyabean casein digest medium , magnesium chloride anhydrous grade 100g molecular biology grade , polyethylene glycol average mol wt 3 350 250g , colchicine 1g , nuclease free water 10x50ml depc treated for molecular biology , glutaraldehyde solution 25 in h2o , whatman quantitative filter papers ashless grade 589 1 black ribbon circles diam 185mm pack of 100 , acetic acid glacial 100 anhydrous for analysis emsure , filter tip in rack 200ul 96 tips x 10 racks x 10 packs box , filter tip in rack 1000ul 96 tips x 6 racks x 10 packs box , serological pipette crystal grade polystyrene ps sterile individually packed 5ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 10ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 25ml pieces sleeve 1 pieces inbox 100 pieces case 400 , cryovial externally threaded clear total volume 1 2ml packed in 50 500 sterile , alkalinity total for 50 tests , calcium hardness for 50 tests , hardness for 50 tests , magnesium for 50 tests , nitrate for 50 tests , nitrate n for 50 tests , nitrate nano2 for 50 tests , ph phenol red for 50 tests , phosphate lr for 50 tests , potassium for 50 tests , sulfate for 50 tests , staphylococcus aureus atcc 25923 , staphylococcus aureus subsp atcc 29213 , staphylococcus aureus subsp atcc 43300 , k pneumoniae atcc 700603 , k pneumoniae atcc baa 1705 , e coli atcc 25922 , coagulase plasma from rabbit , tryptone broth w 10 nacl , baird parker agar medium , alkaline peptone water , ec broth , ampicillin dextrin agar base , potato dextrose agar , potato dextrose broth , levine eosin methylene blue agar medium , glucose peptone agar , chloramine t hydrate , oxytetracycline dihydrate , d galactose , d mannitol , d mannose , d xylose , inositol , dulcitol , l rhamnose monohydrate , d sorbitol , d raffinose pentahydrate , d trehalose dihydrate , adonitol , d salicin , d melibiose monohydrate , esculin fermentation broth , gelatin hi lr , sodium hydroxide , simon citrate agar , sm agar , sim medium , starch agar , indole nitrate medium , urea agar base , glucose of medium , phenol red broth base , mr vp medium buffered glucose broth , dnase test agar w methyl green , triple sugar iron agar , ornithine decarboxylase broth , lysine decarboxylase broth , arginine dihydrolase broth , glycerol hi ar , tryptone soya broth soyabean casein digest medium , esculin agar , muller hinton agar , gram stains kit , durham tubes , o gene ruler 1kb dna ladder , o gene ruler 100bp dna ladder plus , taq dna polymerase recombinant 5 u ul , dntp mix 10mm each , water nuclease free molecular biology grade , 6x loading dye solution , lysozyme , storage vial self standing pp with hdpe closure , cryo babies , laser cryo babies , tough tags //bid details 2 / 122 , spinwin tube conical bottom pp with hdpe closure 15 ml , slid box ps , autoclavable bags pp , sample bags ldpe , beaker pmp , beaker pp , sodium hippurate , acetone , 1 butanol , ninhydrin , tagatose , dnase test agar , nutrient gelatin agar , triple sugar iron agar , phenol red dextrose broth , phenol red sucrose broth ,

CTN :42298520

24 Oct, 2025 NA

Jodhpur - Rajasthan

Tender For supply of rollers , filter body fluid , button horn , tail light assy rh , lamp assy fornt fog

CTN :41114893

18 Oct, 2025 2.16 Crore

Pune - Maharashtra

Tender For bid to ras bid to ras bid to ras bid to ras corrigendum : supply of bur 6 mm , round fine diamond bur 6 mm , skeeter otoflex bur 0.6 mm blue , skeeter otoflex bur 0.7 mm green , skeeter otoflex bur 0.8 mm yellow , skeeter otoflex bur 1.00 mm orange , hla b 27 ssp 96 test , adhesive plaster, zinc oxide, 2.5 cm x 1 mtr , disposable high clarity polypropyline conical centrifuge tube 15 ml , knife bard parker, blade size 1, fitting commercial no.11, packet of 6 , knife bard parker, blade size 2, fitting commercial no. 20, packet of 6 , micropore 5cm width , trypsin edta solution t001 pack of 100ml , vaccum blood collection tubes with needles sodium citrate, 3ml , capd fluid 7.5percentage, 02 lit bag with minicap , stent neuro, self expandable for intracranial aneurysm neck remodeling, 4.5 x 20 mm such as lvis from microvention neuroform from stryker , primary anti body for paraffin section mum1 for ihc pre diluted ready to use vial of 6oblique7 ml rtu , primary anti body for paraffin section concentrated pan ck cytokeratin rabbitobliquemouse monoclonal , primary anti body for paraffin section pre diluted ready to use vial of 6oblique7 ml , rtu ki67 rabbitobliquemouse monoclonal , primary anti body for paraffin section pre diluted ready to use vial of 6oblique7 ml , rtu beta catenin rabbitobliquemouse monoclonal , antibody for ihc bob 1 ready to use , antibody for ihc myo d1 concentrated , primary anti body for paraffin section kappa for ihc pre diluted ready to use vial of 6oblique7 ml rtu , antibody for ihc ae1obliqueae3 ready use , antibody for ihc cd 43 monoclonal mouse anti human ready to use , antibody for ihc moc 31 ready to use , carbonic anhydrase antibody ready to use for ihc , primary anti body for paraffin section afp for ihc pre diluted ready to use vial of 6oblique7 ml rtu , primary anti body for paraffin section pre diluted ready to use vial of 6oblique7 ml , rtu ini1 rabbitobliquemouse monoclonal , inhibin alpha monoclonal antihuman antibody for ihc rtu , cover slip 50 x 22 , cytospin filter cardscompatible with shadon cytospin box of 200 cards , filter paper 100 per pkt , xylene xylol pure , tissue cassettes and block holder , universal ihc polymer hrp detection system 1000 testobliquekit with blocking reagent, dab chromogen, dab substrate and wash buffer 20x target retriever system soln high ph 50x and low ph 50x mouse , diamond marker pencil , ethyl alcohol absolute molecular biological grade , gold chloride 1percentage , iron stain ready to use , reticulin stain kit for histopath ready to use , slide microscopic, poly llysine coated frosted, thickness 1.15 to 1.36 mm size 75 mm x 25 mm , stain eosin water soluble , tris buffer conc 50x, 500 mlobliquepack , grocotts methenamin silver stain , masson trichrome mt stain kit ready to use , filter paper 125 mm , acid, hydrochloric arrenic fire. , ehrhich haematoxylin stain ready to use bottle of one lit , primary anti body for paraffin section concentrated ki67 rabbitobliquemouse monoclonal , antibody for ihc cdx2 ready to use , cmv cytomegalovirus monoclonal mouse anti human ready to use , schiff s reagent ready to use , disposal flexible uretero renoscope , disposable flexible cystoscope with acessories foreceps and y connector , ureteric catheter 70 cm open end size 6 fr , amplatz type renal sheath 18 fr id x 17 cm , ureteroscopy irrigation system path finder , urethral dilator set disposable one set consisting of seven dilators 820zfr , high frequency 24 fr 0.2 wire medium 30 degrees sterile disposable resection electrode //bid details 2 / 72 loop single stem olympus for saline turp cat no wa22306d , hf cable bipolar 4m for esg400 , siliconised ellicks evacutuor , retrieval forceps alligator 7 fr 40 cm rigid

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Dna Polymerase Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

Central Government And Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector