Web Analytics Made Easy - StatCounter

Dna Polymerase Tenders

Get complete information related to latest Dna Polymerase Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Dna Polymerase Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Dna Polymerase Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :42283512 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of 100 bp dna ladder dye plus , 50 bp dna ladder dye plus , 10bp dna ladder dye plus , rnase a 50 mg , proteinase k 100 mg , tris acetate edta buffer tae 50x powder ph8 3 , tris borate edta buffer tbe powder ph8 3 , tris edta buffer te 10x powder ph7 4 , 6x loading dye , rnase free water 1000 ml , dna off dna destroys agent surfac clining , ethidium bromide , tween 20 , edta disodium salt , edta , sodium dodecyl sulfate sds , phenol , ethanol mb grade , mercaptoethanol , polyvinylpyrrolidone pvp , chloroform ar acs grade , sodium acetate , sulphuric acid ar acs grade assay min 98 pack of 2 5 ltr in glass bottle nabl iso iec 17025 2017 certificate required , nitric acid ar acs grade assay 68 70 pack of 2500 ml in glass bottle nabl iso iec 17025 2017 certificate required , ammonium molbdate ar grade assay min 99 pack of 250 g , dimethyl sulphoxide dmso ar grade 99 pack of 500ml , tris buffer ar acs 99 9 pack of 500g , tris hydrochloride tris hcl assay 99 pack of 500g , sodium chloride acs grade assay 99 9 pack of 500g , perchloric acid 70 ar acs grade assay min 70 pack of 500 ml in glass bottle nabl iso iec 17025 2017 certificate required , agarose molecular biology grade white to off white powder moisture content 8 gel strength g cm2 1200 min dnase rnase protease none detected pack of 500g , cetyltrimethyl ammonium bromide ctab assay 99 pack of 500 g , phenol chloroform isoamyl alcohol 25 24 1 ph 8 0 , fe hedta n 2 hydroxyethyl ethylenediaminetriacetic acid extrapure 99 iron fe content 12 14 pack of 500 g , isopropanol acs grade assay 99 5 pack of 1 ltr , tris saturated phenol ph 8 mb grade dnase rnase protease not detect pack of 100ml , pcr grade extrapure mgcl2 25 mm pack of 10 ml , taq dna polymerase 10x buffer with mgcl2 5u ul 5000u the polymerase is supplied with separate tubes of buffer mg2 plus and dntps pack of 250ulx20 , tris buffer ar acs for molecular biology 99 9 assay 99 9 pack of 1kg , sodium hydroxide naoh acs grade , dithiothreitol dtt if working with protein sensitive dna extractions

Central Government/Public Sector

CTN :42291516 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of solution 100mm , mem non essential amino acids solution 100x , 1n hydrochloric acid solution sterile filtered 10 x 20 ml , parafilm m sealing film 100mm 38mtr dimension mm 132x135x112 , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 22um 25mm diamtere with prefilter sterile , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 45um 25mm diamtere with prefilter sterile , sterifast in 500ml dispenser bottle w pump , hishield hand wash in 1 lit can pack , germitol 5 lit can pack , steriswift disinfectant wipes size 6x8 , glycerol 1 2 3 propanetriol for molecular biology , calcium chloride anhydrous cell culture tested , luria bertani agar miller , tryptone soya agar casein soyabean digest agar , tryptone soya broth soyabean casein digest medium , magnesium chloride anhydrous grade 100g molecular biology grade , polyethylene glycol average mol wt 3 350 250g , colchicine 1g , nuclease free water 10x50ml depc treated for molecular biology , glutaraldehyde solution 25 in h2o , whatman quantitative filter papers ashless grade 589 1 black ribbon circles diam 185mm pack of 100 , acetic acid glacial 100 anhydrous for analysis emsure , filter tip in rack 200ul 96 tips x 10 racks x 10 packs box , filter tip in rack 1000ul 96 tips x 6 racks x 10 packs box , serological pipette crystal grade polystyrene ps sterile individually packed 5ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 10ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 25ml pieces sleeve 1 pieces inbox 100 pieces case 400 , cryovial externally threaded clear total volume 1 2ml packed in 50 500 sterile , alkalinity total for 50 tests , calcium hardness for 50 tests , hardness for 50 tests , magnesium for 50 tests , nitrate for 50 tests , nitrate n for 50 tests , nitrate nano2 for 50 tests , ph phenol red for 50 tests , phosphate lr for 50 tests , potassium for 50 tests , sulfate for 50 tests , staphylococcus aureus atcc 25923 , staphylococcus aureus subsp atcc 29213 , staphylococcus aureus subsp atcc 43300 , k pneumoniae atcc 700603 , k pneumoniae atcc baa 1705 , e coli atcc 25922 , coagulase plasma from rabbit , tryptone broth w 10 nacl , baird parker agar medium , alkaline peptone water , ec broth , ampicillin dextrin agar base , potato dextrose agar , potato dextrose broth , levine eosin methylene blue agar medium , glucose peptone agar , chloramine t hydrate , oxytetracycline dihydrate , d galactose , d mannitol , d mannose , d xylose , inositol , dulcitol , l rhamnose monohydrate , d sorbitol , d raffinose pentahydrate , d trehalose dihydrate , adonitol , d salicin , d melibiose monohydrate , esculin fermentation broth , gelatin hi lr , sodium hydroxide , simon citrate agar , sm agar , sim medium , starch agar , indole nitrate medium , urea agar base , glucose of medium , phenol red broth base , mr vp medium buffered glucose broth , dnase test agar w methyl green , triple sugar iron agar , ornithine decarboxylase broth , lysine decarboxylase broth , arginine dihydrolase broth , glycerol hi ar , tryptone soya broth soyabean casein digest medium , esculin agar , muller hinton agar , gram stains kit , durham tubes , o gene ruler 1kb dna ladder , o gene ruler 100bp dna ladder plus , taq dna polymerase recombinant 5 u ul , dntp mix 10mm each , water nuclease free molecular biology grade , 6x loading dye solution , lysozyme , storage vial self standing pp with hdpe closure , cryo babies , laser cryo babies , tough tags //bid details 2 / 122 , spinwin tube conical bottom pp with hdpe closure 15 ml , slid box ps , autoclavable bags pp , sample bags ldpe , beaker pmp , beaker pp , sodium hippurate , acetone , 1 butanol , ninhydrin , tagatose , dnase test agar , nutrient gelatin agar , triple sugar iron agar , phenol red dextrose broth , phenol red sucrose broth ,

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337 Due date: 31 Oct, 202531 Oct, 2025 6.22 Lacs
Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

Central Government/Public Sector

CTN :42211491 Due date: 30 Oct, 202530 Oct, 2025 NA
Tender For supply of chemical e e -macro tips 5ml , ammonium sulphate for plant tissue culture 500 gm , calcium chloride dihydrate for tissue culture 500 gm , sucrose for tissue culture 5 kg , sodium thiosulphate anhydrous extrapure ar 500 gm , agar tissue culture tested 500 gm , wide mouth bottle ldpe , wide mouth square bottle hdpe , jerrican hdpe , wash bottle new type , analytical long stem funnel pp , accupipet-starter kit , macro tips 5 ml , spinix- vortex shaker , spinwin mc-00 micro centrifuge , nitrile gloves powder free , kimwipes wipes , test tube cap pp , planton , staining box pp , biohazard bags pp , autoclavable bags pp , 5-sulphosalicylic acid dihydrate acs , tris buffer for hplc 99 9 , luria bertani broth , luria bertani agar , n-hexane pure 99 , agarose high eeo for molecular biology , citric acid anhydrous extrapure 99 , sodium bicarbonate extrapure, 99 , silica gel blue self indicating coarse 58 mesh , boric acid extrapure 99 5 , phytic acid sodium salt hydrate insp6 extrapure 70 , polyethylene glycol 6000 powder peg 6000 , isopropanol ipa for molecular biology 99 8 , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof a , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof b , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof c , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof d , longamp taq dna polymerase 500 units , q5 high-fidelity dna polymerase - 100 units , ecori - 10000 units , bamhi - 10000 units , hind- iii-hf - 10000 units , bsai-hf v2 - 1000 units , primescrip 1st strand cdna synthesis kit , e coli dh5 competent cells , e coli dh5 competent cell , mighty cloning reagent set blunt end , mighty cloning reagent set blunt end s , water nuclease free , murashige skoog medium w o sucrose agar , hwso9 , hwg09 , salicyclic acid , indole-3-acetic acid iaa , 6-aminopurine vitamin b4 , gibberellic acid ga3 , jasmonic acid , ethephon , generuler 50 bp dna ladder ready-to-use 50 g , generuler 1 kb dna ladder 5 x 50 g , dntp set 100 mm solutions 4 x 1 ml , dreamtaq dna polymerase 500 u , 6x dna loading dye 5 x 1 ml , water nuclease-free 4 x 1 25 ml , water nuclease free 30 ml , phusion high-fidelity dna polymerase 100 u , 0 510 l universal fit gentip natural, bulk low retention non sterile , 100 1000 l universal fit gentip natural, bulk bevelled low retention non sterile , 0 2ml clear 96 well pcr plate no skirt high profile , sealing mat for 96 pcr plate white , storage rack for 1 5 2 0ml tubes assorted 100 well , autoclave bags 415 x 600mm , centrifuge tube with cap conical, sterile racked , 25 well pc rack , micro tube rack 1 5 ml , digital micro pipette , tips for gensleek-10000 clear , parafilm m sealing film , silicone lab mat , magbox , cube tube rack , adapt-a-rack , floating microtube rack , sample container , carboys with stopcock , 4-layer pp activated carbon lab mask , tough-tags , thermo-labserve soft blue nitrile gloves , thermo-labserve soft blue nitrile glove , kimberly-clark purple nitrile gloves-m , safeskin purple nitrile gloves-l , ethanol molecular biology grade , autoclavable bag , accupipette 1 5ml , moisture proof bottle with inner lid 1 litre , cuvettes disposable 4ml , test tube basket 160 160 160 mm , face mask , porcelain buchner funnel , ceramic heater quartz tube-4l , double distillation unit 2 5 lph with quartz heater , ceramic //bid details 2 / 61 heater_quartz tube 2 5 l accs , circulating water bath 12 ltr , magnetic stirrers heat stir , hot plate , glass dryer

Central Government/Public Sector

CTN :42181349 Due date: 28 Oct, 202528 Oct, 2025 NA
Tender For supply of chemical - phenol 500gpk , goat anti bovine igg h l secondary antibody hrp , sheep anti bovine igm secondary antibody hrp 1mg pk , gelatin from bovine skin 500g pk , protein g peroxidase from streptococcus sp 250ug pk , o phenylenediamine dihydrochloride 100tab , rb 2x taq pcr master mix premix taq dna polymerase with dntps and buffer with green dye 500rxn , anti human igg fe specific peroxidase antibody produced in goat 1ml pk , anti human igm u chain specific peroxidase antibody produced in goat 1ml pk
 Loading, Please wait...

Connect us via What's Up