Latest dry chemical powder Tenders | Government dry chemical powder Tenders

Central Government/Public Sector

CTN :39858877

14 Apr, 2025 2.81 Lacs

Korba - Chhattisgarh

Tender For supply of abc dry chemical powder, part no. - 100194 , fire detection tube, part no. - 7000100 , line joint connector - tube, part no. - 200116 , manual actuator, part no. - 200110 , tee connector, part no. -200132 , monitoring pressure switch, part no. - 200119 , bsp hose adapter, part no. - 100183 , male elbow tube, part no. - 200126 , pressure gauge, part no. - 100127

Central Government/Public Sector

CTN :39847883

07 Apr, 2025 NA

Bhadravati - Karnataka

Tender For supply of dry chemical powder (dcp) as per is 4308 (q2)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :34734255

30 Dec, 2023 2.50 Lacs

Multi City - Telangana

Tender For corrigendum : procurement of afdss spares for cat dumper working at ocp3, rg2 on specific make basis - dry chemical powder, actuation device:electro mech slenoid va, hp hose assy.1/4"33"long, stand for 30kg cylinder&cartridge mount, dcp cylinder 15 kg.

CTN :39835192

05 Apr, 2025 NA

Coimbatore - Tamil Nadu

Tender For supply of assistance for safety and mech services unit rate to be calculated based on semi skilled rate margins , maintenance of dcp fire extinguisher 9kg , servicing of fire extinguisher 25kg and 75kg , servicing of fire extinguisher 1kg to 4.5kg , refilling of co2 gas 2kg to 6.8kg , refilling of fire extinguisher 9kg , dcmp mock drill arrangements , foam pourer testing , hydrotesting fire hose , supply of dry chemical powder , supply and fixing hose,dcp,9kg , fabrication, welding and erection of structural steel , supply and installation safety clip and safety pin , supply and installation discharge hose for 25kg dcp , supply and installation discharge hose for 75kg dcp , supply and installation discharge hose for 4.5kg co2 dcp , supply and installation discharge horn,4.5kg co2 dcp , supply and installation discharge horn,2kg co2 dcp , ultrasonic testing of fire extinguisher , supply and installation luminous wind sock , supply and installation connecting hose , servicing of sprinkler nozzle , servicing of fire hose , welding of pipe all dia , supply and installation of butterfly valve , supply and installation coupling washer , cleaning of strainer 6 inches and above -product line , cleaning of strainer upto 6 inches - product line , supply and installation of 80mm ci butterfly valve , supply of spark arrestor , supply of fire hose,15mt , supply and installation of sprinkler nozzles , supply and installation fire hose box glass , supply of jet nozzle , supply and installation of hose box , refilling of clean agent cylinder , supply and installation of hydrant cap , cleaning of strainer upto 6 inches for hydrant lines , cleaning of strainer 6 inches and above for hydrant lines , additional manpower assistance , hydrotesting of pipeline , supply, application and wrapping for underground pipeline , testing and calibration of tsv and srv , testing and servicing of pv vent,3 inch , testing and servicing of pv vent,6 inch , hiring of hydra crane , pipe modification product drain , hiring of jcb , supply and installation of gland rope for valves , supply and filling of silica gel , hydrotesting of unloading hose , cleaning and greasing of gate valve upto and including 6 inches , cleaning and greasing of gate valve 8 inch and above , servicing of gear operated valves , maintenance of swing ladder , repairing of swivel joint , supply and installation of bolt and nuts , supply and installation of gasket sheet , supply of structural steel erection aligment and welding , refilling of scaba cylinder 200bar and 300bar , product tank cleaning ag tank , removing of dead stock ag and ug tanks , product tank cleaning ug tank , servicing of deluge valve

CTN :39562162

29 Mar, 2025 11.64 Lacs

Bardhaman - West Bengal

Tender For corrigendum : procurement of afdss system spares applicable to cat 773e dumpers - control panel asm. for two zone system, part no. acfz29222 , sensor cable, part no. ac505027 , dry chemical powder, part no. ac42511001 , co2 expellant gas cartridge 300 gm, part no. acfz11002 , actuation device, part no. acfz11001 , sensor end assembly for zone wise, part no. acfz23003 , nozzle conical brass, part no. acfz13008 , dust cap for nozzle, part no. acfz14010 , horn unit for zone wise, part no. acfz22002 , pilot cyl assy f manual operation, part no. ac502018 , harness cable assembly with connector, part no. acfz21001 , expellant gas cartridge 200gm, part no. ac501025 , mounting block for hoses, part no. ac507065 , dcp cylinder 15 kg, part no. ac502014

Central Government/Public Sector

CTN :39772849

11 Apr, 2025 79.5 Thousand

Korba - Chhattisgarh

Tender For supply of dry chemical powder, part no. se53753 , co2 cartridge 400 gm, part no. se539941 , rupture disc assy - dcp cylinder, part no. se54686

Central Government / Public Sector

CTN :39698408

01 Apr, 2025 NA

Angul - Odisha

Tender For corrigendum : supply of dry chemical powder (dcp) as per is 4308 (q2)

Central Government/Public Sector

CTN :39788146

11 Apr, 2025 NA

Multi City - Multi State

Tender For supply of dry chemical powder abc store pressure type portable fire & safety called multipurpose use d duly chared with mono ammonium phosphate base powder refill & pressured with pure nitrogen gas. ext inguishers are with heavy-duty squeeze grip brass valve, indicating pressure gauge, pvc nossel, safety loc k with pin & heavy-duty wall mounted bracket. extinguishers are made up to is:15683 specification with isi mark. hsn code: 84241000. [ warranty period: 30 months after the date of delivery ]

CTN :39513554

26 Mar, 2025 25.09 Lacs

Ramgarh - Jharkhand

Tender For corrigendum : tender for supply of spares for afdss for hemm - control unit assy part no se57110 , horn unit part no se57392 , over ride unit part no se54453 , end of line resistor unit part no se53799 , sensor cable assembly part no se53944 , sensor cable assy part no se53727 , cable assy main part no se57716 , main cable assy part no se57170 , dcp cylinder 20kg part no se57510 , nitrogen cylinder assembly 0.5 lit part no se57112 , pilot cylinder assembly part no se57322 , portable cylinder part no se53836 , teflon bush part no se543351 , sensor mounting clip part no se54462 , dust cap part no se53835 , nozzle conical part no se53508 , coupler 1/2 in part no se53518 , 3/4 inch coupler part no se53570 , elbow 1/2 inpart no se535021 , distributor 5 way part no se535121 , dry chemical powder part no se53753 , rupture disc assy dcp cylinder part no se54686 , c02 cartridge 300gm part no se53994 , non return valve part no se53762 , high pressure valve part no se54190 , pressure gauge part no se54180 , locking pin assy override part no se55093 , tee 3/4 inch bsp part no se53757 , dcp cylinder mounting bracket part no se57519 , cylinder clamp part no se57491 , pipe cross 4 way part no se535123 , over ride unit bracket part no se57117 , over ride unit part no se53605 , m6 x 25 bolt part no se53681 , m8 x 20 bolt part no se53608 , spring washer m8 part no se53609 , bolt m8 x 50 part no se53702 , bolt m8 x 65 part no se53610 , nut m6 part no se53634 , m8 nut part no se53611 , m10 spring washer part no se53607 , spring washer m8 part nose53609 , m10 nut part no se53606 , fuse 3a part no se53557 , splicing connector part no se54539 , m6 x 12.5 bolt part no se53625 , m10 boss part no se53635 , cntl unt mtg bckt part no se57263 , tapped pad control unit part no se53884 , tee 1/4 inch part no se53718 , 1/4 inch hose assy. l bend on one end part no se5352227 , 1/4 inch hose assembly part no se5352245 , 1/4 inch hose assembly pt. no. se5352215 , 1/2inch hose assy (800 mm) part no se5352212 , 1/2 in hose assy , 1100mm part no se535226 , 1/2 inch hose assy part no se535848 , 1/2 hose assy part no se5352210 , 1/2hose assy part no se535229 , 1/2 inch hose 2000 mm part no se535849 , 1/2 inch hose assy (3000 mm) part no se535847 , 3/4 in hose assy , 1000mm part no se5358412 , 3/4 hose assy part no se5352224 , 1 / 2 inch hose assy part no se535842 , 3/4inch hose assy. part no se5352223 , 3/4inch hose assy. part no se5352222 , 3/4 in hose assy , 3000mm part no se5358416 , 3/4 inch hose assy part no se5352221

Dry Chemical Powder Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector

Central Government/Public Sector