Latest ester Tenders | Government ester Tenders

CTN :36327567

28 Jun, 2024 NA

Pallikaranai - Tamil Nadu

Tender For supply of consumables for gas chromatography - oasis hlb cartridges , oasis wax cartridges , quartzmicrofiber filters , glass microfiber filters , silica gel ,silanized glass wool , pfos pfoa pfhxs labeled standardmixture , method 8327 surrogate spiking mixture in methanol , perfluorohexanesulfonic acid , perfluorooctanesulfonic acid , phthalic acid, bis-butyl ester d4 , phthalicacid, bis-2-ethylhexyl ester d4 , bisphenol f-d10 , 24bisphenol s-d8 |

Central Government And Public Sector

CTN :36327960

28 Jun, 2024 NA

Mumbai - Maharashtra

Tender For supply of consumables and reagent of sigma thermofisher milliporeproducts bisphenola 100mg, 100mg bisphenols , 51453 bisphenolf 100mg , mono-methyl phthalate-100mg cat no. 36926, bis(2-ethylhexyl) phthalate -100mg cat no. 67261, acetonitrile 1l cat no. 34998, mono-benzyl phthalate-100mg cat no. 89505, methylparaben 1g cat no. phr1012, propylparaben 1g cat no. phr1010, ethylparaben 1g cat no. phr1011, butylparaben 1g cat no. phr1022, 90477 bisphenolaf 100mg , glass fiber membrane filter, 0.7 um 100 filters cat no. apff04700, tetramethylammonium hydroxide solution 250ml cat no. 426318, millex r mce syrige filter 0.22 um, egta molecular biology grade 25g cat no. 324626, vials, screw top, amber glass (vial only) 2ml cat no.27083-u, mono-butyl phthalate 100mg cat no. 30751, monoethyl phthalate 10mg cat no. smb00941, phthalic acid mono-2-ethylhexyl ester 500mg cat no. 796832, methanol 2.5l cat no. 106018, ammonium acetate 25g cat no. 73594, b-glucuronidase 5ml cat no. bgals-ro, formic acid 98 percentage - 100percentage 50ml cat no. 533002, p8044 proteinase k tritirachium album 250 mg, benzyl 4 hydroxybenzoate 100g cat no. 380709, ufc9003 ultra centrifugal filter, hydrogen peroxide 30 percentage in water 500ml cat no. bp2633500 cas no. 7722-84-1, bamhi(100/ul) cat no. er0051, ultrapure(tm) dnase/rnase-free distilled water 500ml cat no. 10977015, dnase i solution (2500 u/ml)-0.5ml cat no. 90083, exosap-it(tm) pcr product cleanup reagent- cat no. 78200.200.ul, pbs - phosphate-buffered saline (10x) ph 7.4, rnase-free 500ml cat no. am9624, phosphate buffer ph.7 500ml cat no. 38385 -

CTN :36309093

27 Jun, 2024 NA

Mumbai - Maharashtra

Tender For supply of fatty acid unsaturated kit , fatty acid methyl ester unsaturated kit

CTN :36303297

26 Jun, 2024 NA

Ghaziabad - Uttar Pradesh

Tender For procurement of insecticide for pest control - 2 to 4 d ethyl ester 38 percentage , atrazine , emamectin benzoate 5 percentage sg a bottle of 250 gm , chlorpyriphos 50 percentage slash cypermetrhin 05 percentage ec , phorate , pendamethalin

Central Government/Public Sector

CTN :36305326

21 Jun, 2024 NA

Multi City - Multi State

Tender For supply of 2024-25 (ami no. 26dr 009) dressing made of grey polyurethane ester material rod with center perforations for ease of separation into halves pore size should be 133-600 microns depends on direction, canister 1000ml with gel and cassette which holds the solutions or saline for instillation. cleanse%u2122 or equivalent us fda approved /bis

Central Government/Public Sector

CTN :36283663

20 Jun, 2024 NA

Chennai - Tamil Nadu

Tender For supply of list of phthalates - supply of list of phthalates, di-butyl phthalate (dbp), 500mg, butyl benzyl phthalate (bbp), 100mg, bis-(2-ethylhexyl) phthalate (dehp), 500mg, di-n-octyl phthalate (dinp), 100mg, di-iso-nonyl phthalate (dinp), 100mg, di-iso-decyl phthalate (didp), 100mg, di-isobutyl phthalate (dibp), 100mg, bis-(2-methoxyethyl) phthalate (dmep), 100mg, di-iso-pentyl phthalate (dipp), 25mg, n-pentyl-isopentyl phthalate (pipp), 25mg, di-n-pentyl phthalate (dnpp), 100mg, di-iso-hexyl phthalate (dihxp), 100mg, di-n-hexyl phthalate (dnhp), 100mg, butyl octyl phthalate (bop), 100mg, 1,2-benzene-dicarboxylic acid,di-c6- 8-branched alkylnesters,c7-rich (dihp), 100mg, di-iso-octyl phthalate (diop), 100mg, di--undecyl phthalate (dup), 100mg, 1,2-benzene-dicarboxylic acid,dipentyl ester,branched and linear (dpp), 100mg, 1,2-benzene-dicarboxylic acid,dihexyl ester,branched and linear (dhp), 100mg, 1,2-benzene-dicarboxylic acid,di-c7- 11-branched and linear alkyl esters (dhnup), 250mg, 1,2-benzene-dicarboxylic acid,di-c6- 10-alkyl esters;1,2-benzene-dicarboxylic acid,mixed decyl,hexyl and octyl diesters with 0.3% of diheyl phthalate, 100mg, di-ethyl phthalate (dep), 500mg, dimethyl phthalate (dmp), 500mg, di-cyclo hexyl phthalate (dchp), 100mg, di-n-propyl phthalate (dprp), 100mg, di-nonyl phthalate (dnp), 100mg, packing and forwarding charges

Central Government/Public Sector

CTN :36286791

13 Jun, 2024 NA

Vellore - Tamil Nadu

Tender For supply of glass flake lining of absorber outlet duct, ggh, drain pits and slab drain below vbf - glass flake lining bong panki - sch-1-sl. no.-1- l15091fw26501001 supply of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet unit 1 , sch-1-sl. no.-2- l15091fw26501002 application of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet unit 1 , sch-1-sl. no.-3- l15091fw26501003 supply of 2mm vinyl ester based glass flake lining in ggh unit 1 , sch-1-sl. no.-4- l15091fw26501004 application of 2mm vinyl ester based glass flake lining in ggh unit 1 , sch-1-sl. no.-5- l15091fw26501005 supply of 2mm vinyl ester based glass flake lining for drain pits trenches and slab drain below vacuum belt filter , sch-1-sl. no.-6- l15091fw26501006 application of 2mm vinyl ester based glass flake lining for drain pits trenches and slab drain below vacuum belt filter , sch-1-sl. no.-7- l15101fw26501001 supply of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet l15101fw26501001 unit 2 , sch-1-sl. no.-8- l15101fw26501002 application of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet unit 2 , sch-1-sl. no.-9- l15101fw26501003 supply of 2mm vinyl ester based glass flake lining in ggh unit 2 , sch-1-sl. no.-10- l15101fw26501004 application of 2mm vinyl ester based glass flake lining in ggh unit 2 , sch-1-sl. no.-11- l15111fw26501001 supply of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet unit 3 , sch-1-sl. no.-12- l15111fw26501002 application of 2mm vinyl ester based glass flake lining of absorber outlet duct to ggh inlet unit 3 , sch-1-sl. no.-13- l15111fw26501003 supply of 2mm vinyl ester based glass flake lining in ggh unit 3 , sch-1-sl. no.-14- l15111fw26501004 application of 2mm vinyl ester based glass flake lining in ggh unit 3 , sch-2-sl. no.-1- l15281fw26501001 supply of 1.2mm gfl for comp inlet duct , sch-2-sl. no.-2- l15281fw26501002 application of 1.2mm gfl for comb inlet duct , sch-2-sl. no.-3- l15281fw26501003 supply of 1.2mm gfl for abs inlet duct , sch-2-sl. no.- 4- l15281fw26501004 application of 1.2mm gfl for abs inlet duct , sch-2-sl. no.-5- l15281fw26501005 supply of 2mm gfl for ggh , sch-2-sl. no.-6- l15281fw26501006 application of 2mm gfl for ggh

CTN :36266774

21 Jun, 2024 NA

Mumbai - Maharashtra

Tender For supply of p-chx-a-benzyl-dtpa , p-ncs-benzyl-dota , dota-tris(tert butyl ester)

CTN :36238653

08 Jun, 2024 NA

Bhandara - Maharashtra

Tender For supply of plasticizer ester

Central Government And Public Sector

CTN :36239695

14 Jun, 2024 9.08 Lacs

Mumbai - Maharashtra

Tender For supply of consumables and kits for medical research misc1 - n5751-5g l-name 5gm nw-nitro- l-arginine methyl ester hydrochloride , 1610377 precision plus protein dual xtra prestained protein standards 500ul , e-el-r0026 rat leutinizing hormone lh elisa kit 96 tests , e-el-r0391 rat follicle stimulating hormone fsh elisa kit 96 tests , e el-0154 progesterone elisa kit 96 tests , e-el-r3006 rat prolactin hormone prl elisa kit 96 kit , p034-100r salsa mlpa p034 dmd-1 probe mix 100 reactions , p035-100r salsa mlpa p035 dmd-2 probe mix 100 reactions , ek1- fam salsa mlpa ek1 reagent kit 100 reactions 6 vials 100 reactions -fam , 07j68-001 thermobrite humidity strips , a12216 amplex red cholestrol , a22189 amplex red glucose 1gu , a12221 amplex red glutamic ac , a22188 amplex red hydrogen pe , a33855 amplex red ultra red stop reagent , q32856 qubit assay tubes set of 500 , custom morpholino 5ctccagcccagtctgcccatcgag3 carboxyfluorescein 300nmol , standard control oligo - 3 fluorescein 300nmol , ek-075-40 leap-2 38-77 elisa kit , mb228-500ml , 61808 pyridine 500ml

Ester Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector