Latest ferric chloride Tenders | Government ferric chloride Tenders

CTN :39724420

18 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For corrigendum : supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), sto

Central Government/Public Sector

CTN :39921725

25 Apr, 2025 NA

Salboni - West Bengal

Tender For supply of ferric chloride, technical as per is 711 (q3)

CTN :39873483

16 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For corrigendum : supply of ferric chloride is: 711 min. 98% by weight , sodium metabisulphite is: 248 min. 60% purity as so2 by mass , sodium hypochlorite is: 11673: 1992 grade: 2 conc 10%

State Government

CTN :39919589

19 Apr, 2025 NA

Patiala - Punjab

Tender For lab kits consumables and other items for rajindra hospital patiala - paper roll, pti kt, g6pd kits, methanol 2.5ltrs bottles, leishman stain powder (bottel), 10% sodium hypchlorite (liters), liquid paraphin (bottels), retic stain (bottels-125 ml), spirit (liters), test tubes, micro capillary tubes (box ), slides (box), westergren pipttes, edta vaccutainers, plain vaccutainer, sodium flouride, pti vaccutainer, esr vaccutainer, urine containers, syringe (20ml), syringe (10ml), syringe (5ml), syringe (2ml), disp.gloves( 7.5), disp.gloves( 7.00), disp.gloves( 6.5), cotton (bundles), bone marrow needle (no.14, bone marrow needle (no.16, bone marrow needle (no.18, jamshidi needle, lignocane 2% 30ml (bottels), micropore (pc), betadine (bottles), urine strips (box), nitrile gloves (box), blotting sheet 2 bundles (1000 sheets ) boxes, cover slip boxes, gentamicin 120mg hlg (vials), ceftazidime + clavulanic acid (30mg+15mg) (vials), ciprofloxacin (30 mg) (vials), ceftriaxone (30 mg)(vials), teicoplanin (30mg) (vials), azithromycin (30mg) (vials), cefoperazone + sulbactam (30 mg+15mg) (vials), nutrient agar (500 gms) boxes, potato dextrose agar (100 gms) boxes, nutrient gelatin (100gms) boxes, of basal media (100 gms) boxes, nitrate broth (100gms) boxes, cled agar with andrade s indicator (500gms) boxes, corn meal agar (500 gms) boxes, hi chrome candida differential agar (100gms) boxes, dextrose (500gms) boxes, sucrose (500gms) boxes, mannitol (500gms) boxes, lactose (500gms) boxes, acetone (litre x 5), lead acetate (500 gm), acid carbolic (500 gm), acid sulphuric (2.5l ), acid acetic, disodium hydrogen phosphate (500 gm), ferric chloride ar (500 gm), glycerine (500 gm), toluidine (gm), i- phenylalanine (500 gm), neutral red (125 gm), acid fuchsin ( 25 gm), basic fuchsin (25gm), potassium tellurite (25gm), sodium taurocholate (500 gm), sodium hydroxide (500 gm), di potassium hydrogen orthophosphate (500 gm), methyl red reagent (100ml), andrade s indicator (100ml), alpha napthylamine (500gm), potassium iodide (100gm), sulphanillic acid 0.8% (100 ml), n, n, n ,n- tetramethyl-p-phenylenediamine dihydrochloride (5g), potassium hydroxide (500gm), widal test kit 4x5ml (to,th,ah,bh) (kits ), crp latex slide agglutination kit (50 tests), ra latex slide agglutination kit (50 tests), aso latex slide agglutination kit (50 tests, ppd 5 tu/ 0.1 ml & 10 tu/0.1 ml (vial), upt strip test, toxoplasma strip test, rpr strip test, hav rapid card, hev rapid card, hep b core antibody igm and igg elisa, rubella igm elisa, cmv igg elisa, hsv-1&2 igm - elisa, petri dish 3 (pc), petri dish 4 (pc), petri dish 4"disposable (pc), durhams tube, over slips (20 boxes (400 packets), blood culture bottles (50ml) 1367019 (bottles), blood culture bottles (160ml) 1367019 (bottles), whatman filter paper rim, filter paper rim (ordinary) (rim), gloves (pair), masks (disposable ), heating elements (autoclave) (elements), insulin syringes, t3 (96 wells), t4 (96 wells), tsh (96 wells), vitamin d 3 (96 wells), lh (96 wells), fsh (96wells), prolactin (96 wells), testosterone (96 wells), psa (96 wells), ca-125 (96 wells), cea (96 wells), ca-15.3 (96wells), alpha fetoprotein (afp) (96wells), ca-19.9 (96 wells), ferritin (96wells), insulin (96 wells, beta hcg (96 wells), amylase, cpk-mb (20x1.1 ml), ldh (20x1.1 ml), cpk total(ck-nac) (15x1.1 ml), phosphorous (2x50 ml), calcium (2x50 ml), micro protein kits for csf (1x50 ml), blood urea kit (2x1 litre), uric acid (4x50 ml), cholestrol 5x20ml, triglycerides 5x20ml, sgot 5x20, sgpt 5x20, alp 5x20 ml, glucose 2x200 ml, total bilirubin 4x50 ml, ammonium sulphate 500gm/(ar) ( packs), disodium phenyl phosphate 100gm per pack (ar) ( packs), trichloracetic acid (tca) ar 500gm ( packs), methanol (ar) 2.5 ltr per pack ( packs), trisodium citrate (ar) 500gm per apck ( packs), methylated sprit (ar) 5lrt per apck ( packs), sodium dihydrogen phosphate (nah2po4) (ar) ( packs), sulphur powder ar 500gm per pack ( packs), liquor ammonia ar 250 m

CTN :39920687

14 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of various chemicals - labchem acetic acid glacial ch3cooh , labchem acetone c3h6o , labchem ammonium acetate c2h7no2 , labchem ammonium chloride , labchem ammonium ferrous sulphate , labchem ammonium hydroxide nh4oh , labchem ammonium molybdate nh4 6mo7o , labchem boric acid h3bo3 , labchem edta c10h16n2o8 , labchem hydrochloric acid hcl , labchem hydrofluoric acid , labchem hydrogen peroxide , labchem bromocresol purple i c21h16br2o , labchem ebt indicator , labchem methyl orange indica c14h14n3na , labchem copper pan indicator c15h11n30 , labchem pr indicator c21h14n2o7 , labchem xylenol orange indic c31h32n2o1 , labchem sdps indicator , labchem iso propyl alcohol , labchem labolene cleaning r , labchem mercuric chloride , labchem methanol ch3oh , labchem orthophosphoric acid h3po4 , labchem oxalic acid c2h2o4 , labchem ph buffer tablets ph 4.00 , labchem ph buffer tablets ph 7.00 , labchem ph buffer tablets ph 9.20 , labchem potassium hydroxide koh , labchem quinoline , labchem silicon grease lubricant , labchem silver nitrate agno3 , labchem sodium bi carbonate nahco3 , labchem sodium meta bisulphite na2s2o5 , labchem sodium potassium tartrate , labchem sodium sulphate anhyhrous , labchem stannous chloride sncl2 , labchem stearic acid , labchem sulphuric acid h2so4 , labchem zinc acetate zn ch3co2 2 , labchem zinc oxide , labchem benzene , labchem glycerol 2.5 l ex , labchem methyl red indicator , labchem perchloric acid , labchem sodium nitrate , labchem sodium peroxide granular , labchem tin metal , labchem ammonium oxalate nh4 2c2o4 , labchem ammonium persulphate , labchem ammonium thiocyanate , labchem citric acid c6h8o7 , labchem dimethyl glyoxime c4h8n2o2 , labchem ethanol , chemical anhydrous ferric chloride fecl3 , labchem hydroxylamine hydrochloride , nisp project material bromocresol green , labchem potassium ferricyani k fe cn , labchem sodium bisulphite , labchem sodium fluoride anhydrous , labchem zinc sulphate hepta znso47h2o , labchem benzoin oxime , chromium oxide iii green 500 gm pack , carnauba wax , carborandum powder mesh 400 , carborandum powder mesh 800 , carborandum powder mesh 1000 , carborandum powder mesh 1200 , conductivity standard 12.88us cm , conductivity standard 1413us cm

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

CTN :39870164

19 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges hospitals in telangana state under rate contract for a period of 2 years - copper sulphate , dpx , eosin , glycerol , hydrochloric acid , hydrogen peroxide 500ml , paraffin wax (58aa to 60aa c) , phenol5lts , sodium borate , sodium citrate , spirit , 1% phospho moiybdic acid , dilute hcl , fehlings a , fehlings b , ferric chloride 10% , mayers reagent solution , molish reagent , picric acid500ml , povidene iodina , waghers reagent , normal saline (ns) , pilots solution , reeseckler diluting fluid , ringer lactate (rl) , brilliant cresyl blue , cedal wood oil , hypochlorite , leishman stain , rbc diluting fluid , 1% calcium chloride , 1% potassium chloride , wbc diluting fluid , xylene2.5 ltr , xylene25 ltr , xylene 500 ml , formalin5lts , distilled water , iodine testing chemical kits , jsb stain solution 1 , microscope oil , n 10 hcl , ortho toulidin reagent , potassium iodide powder , sodium thiosulphate , soil testing chemical kit , starch powder , 30% hydrogen peroxide500ml , 50% slycerol sodium , ethlene floride , formalin , hcl , liquid parafin , nacl , naf , potassium floride , rutherford spirit , sodium azide , sodium hypochlorite , orthovision blood group analyser iqc , anti a , anti b , anti d igm , anti ab , anti ahg , anti a1 lectin , anti h lectin , anti d igg igm , bovine albumin , hydrogen peroxide 1trs , rbc pipettes , wbc pipettes , hb pipette , pen needles , ishiharas charts , jaeger charts , lens cleaning solution , watch glasses , petri dish glass , petri dish plastics

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

Ferric Chloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

corporations/Associations/Others