Latest ferric chloride Tenders | Government ferric chloride Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

Central Government/Public Sector

CTN :39809250

10 Apr, 2025 NA

Bijapur - Karnataka

Tender For supply of 100252594 - 10 - m1010208018 - ferric chloride, liquid

CTN :39798792

27 Mar, 2025 7.50 Lacs

Sirohi - Rajasthan

Tender For supply of lab equipment chemistry - test tubes , safety goggles , latex gloves , bunsen burner , thermometer , microscope , graduated cylinders , conical flasks , boiling flask(tubs) , droppers , pipette , ring stands, rings, and clamps: , burettes , tongs and forceps: , spatulas and scopulas: , litmus and filter papers: , melting point apparatus mechanical type , thieles tube 18x150mm , wening , pocket type conductivity/tds meter , filter paper sheet , water bath , heating mental , watch glass (small-30, large 30) , funnel (plastic-30, glass-30) , volumetric flask 100ml , volumetric flask 250ml , volumetric flask 500ml , volumetric flask 1000ml , glass rod , spatula , measuring cylinder 10ml , measuring cylinder 25ml , measuring cylinder 50ml , reagent bottle n m. 125ml , burner , calorimeter , anthracene , phthalic acid , urea , nepthaline , a-narithol , b-narithol , oxalic acid , cinnamic acid , benzophenone , m-dinitrobenzene (100gm) , hydrochloric acid , starch soluble , potassium dichromate , resorcinol , iodine monochloride , glucose , salicylaldehyde acid , pyridine , acetyl chloride , ethanol , potassium hydroxide pellets , tartaric acid , mercuric chloride , ammonium thiocynates , aniline , benzoil chloride , citric acid , benzoic acid , diphenylamine , ester , nesslar reagent , picric acid , ferric chloride , phenol , thiourea , potassium ferrocynide , potassium iodide , schiff reagent , glycrine , dimethyl gloxime , mangnese dioxide , potentiometer , thermostat (electical) , microwave 21 ltr , electronic malatice (precision) , digital water balt , magnets sturer (1kg) , table top balance (300gm) , stalagmometer , viscometer (ostwald) , beaker (500 ml-20, 100ml-20, 200ml-20, 50ml-20, 1l-3, , 5l-2) , conductivity bridge with flectrode

CTN :39798795

27 Mar, 2025 7.50 Lacs

Sirohi - Rajasthan

Tender For supply of lab items zoology gc reodar- el'plectella,, scyi'ha, hyalonema, spongllla, euspongia, metrldlum, aurelia,, alcyonium,, physalia,, corallium, gorgonia,, pennatula,, madrepora,, enterobius, dugesia, fasciola, taenia, schistosoma, dracunculus, ascaris (male and female), wucheraria, peripatus., nereis, heteronereis,, aphrodite,, arenicola,, chaetopterus, hirudin aria., onychophora :, limvlus,, aranea,, palajvfnaeus,, lepas,, balanus,, apus, sacculina, eupagurus,, carcinus, lepisma, pediculus, bombyx, apis, cimex,, julus,, scolopendra,, ixodes, mytilus., chiton., teredo., turbinella,, laviculus, limax, doris, aplysla, dentalium, nautilus, sepia, octopus, loligo, pecten, solen., pinctada, asterias, pentaceros., antedon., ophiothrjx., holothurla, hemichordata:, l.balanoglo us, 2.saccoglossus., urochordata- ciona, pyrosoma. doliolum salpa, cephalochordata- amphioxus, agnatha- petromyzon. ammocoete larva, pisces -echeneis., sphyr-na., torpedo., pristls., anabas., hippocampus., chjmaer-a.., anguilla,, protopterus, ampidbia, ichthyophts., axolotl larva, . salamander,, bufo., plpa., amphiuma, alytes, trionyx, calotes., varanus., phrynosoma,, heloderm . .<\,, vip era., typhlops, bungarus., hydrophis, eryx., aves-, p lttacula,, passer, bubo,, model of archaeopteryx, mammals, felis, erinaceous,, hystrlx crocedura,, manis, acinonyx juba tus,, equus caballus, mschus moschiferous., columba livia,, pteropus, dr.a,co,, exocoetus,, chamaeleon,, perlpetus, spinel' ant eater, permanent microscopic slides, protozoa, monocystis,, euglena,, noctiluca,, tr yp anosoma,, nyctotherus,, par.a,mecium,, vorticella,, blood smears showing malarial par."site., par."mecium: binary fission, conjugation, porifera, t.s. and l.s. of sycon., spicules,, spongin fffires and gemmules, coelenterata, lo belia (colony and medusa), planula, scyphistoma and ephyra larvae of aurelia,, t.s. of mesentry of metridium, pla tyhelmtnthes, mirl,cidium, sporocyst, redia and cercaria larvae of fasciola,, scolex of taenia, w.m. of mature and gravid proglottids of taenia,, hexacanth and cysticercus larvae of taenia., aschelmtnthes, t.s. of as carl (male and femlu.e), anneuda, t.s. of nereis through different regions,, parapodia of nereis and heteronereis., tro hophore larva., arthropoda:, v.s. of compound eye,, nauplllis, l oea,, megalopa larvae and mysis, mouth parts of insects, head and mouth parts of mosquioeto anapheles, head and mouth part of butterfly, t.s. of shell of la..mellidens,, glochidium larva, echinodermata, t.s.ofarm, tubefeet and pedicel la ria,, bipinnaria larva of starfish,, echlnopluteus larva., . hemichordata :tornerla larva., urochordata-, t.s. through phar ynx show1ng gonads, t.s. through caudal region., pisces, placoid,, cycloid and ctenoid scales, v.s. of skin, amphibia, v.s. of skin,, frog fertilized egg, frog unfertilized egg, frog t.s. of testis,, frog t.s. of kidney, frog-t. s. of liver, reptilia, v.s. of skin and t.s. of stomach., aves, t.s. of inte tine, t.s. of liver, t.s.ofovary, , filoplume w.m ., types of feet and cla ws in birds, mammals, i) t.s. of pancreas,, 2) t.s. of thyroid gland,, 3) l.s . of pltuitar y gland,, 4) t.s. of intestine,, 5) l.s . of kidney,, 6) t.s. of testis and ovary and v.s. of skin, t.s. of lung, embryological slides (individual), chi k embryo: w.m. is hours of incubation, chick embryo: w.m.24 hours of incubation, chick embryo: w.m 36 hours of incubation, chick embryo: w m.72 hours of incubation, chick embryo: w.m.96 hours of incura. tion, frog (disarticulated bones), rabbit bones, fowl bones, v aranus bones, alcohol - ethanol, eosin, xyelne, hemtoxylene, acetocarmin, carnoy's fluid, chloroform, glacial acetic acid, ferric chloride, nacl, sodium citrate, giemsa stain, methylene blue, distilled water, dpx, formaline, toluene,, starch, iodine solution, alcohol - stain- xylene- dpx series bottles, alcohol -st ain-xylene- dpx series stands, slide box, cover slips, alcohol lamps for slide prepara tion, petri dlsh- noj

CTN :39721908

27 Mar, 2025 NA

Netanar - Chhattisgarh

Tender For supply of chemicals for dmro plant and descaling chemicals for vam - chem ferric chloride fecl3 98 , chemical polyelectrolyte powder 100 c , chemical morpholine c4h9no min 9 morp , chemical smbs 100 c , chemical antiscalant 100 c , chemical naocl 8 con , chem dewatering poly 100 , chemical descaling heavy duty , chemical ph booster ro clean 100 c

CTN :39724420

11 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), storage bottles,

CTN :39741269

18 Apr, 2025 10.19 Lacs

Bhopal - Madhya Pradesh

Tender For supply and spares for chlorinator and overhauling of chlorinators at site 50 mld manubhan tekri wtp under bhopal - wall mounted type gas filter suitable for mounting chlorinator on top valve and helps to filterchlorine gas.make: chloro control/capco/capital control, chlorine gas filter cs-1suitable for arresting ferric chloride and other impurities carried outby chlorine gas also to trap the liquid drops. internal quartz made of s.s.316 test pressure to 40 bars.make: chloro control/capco/capital control, chlorine pressure gaugeglycerin or jelly filled diaphragm sealed type range: 0-21 kg/cm2connection: bottom " (m) bsp, container auxiliary isolating valveto is: 3224 aluminum silicon bronze body silver plated and monel metalspindle with teflon gas kit, clamp in one forget steel., tonner clamp for valve, flexible coil connection tube, annealedcopper, pvc sheathed, 6 5/16 nb, 18 swg, test pressure to 40kgs/cm , flexible coil connection fitting setset of: tonner valve wrench key: 01 no.tonner valve connection nut: 08 nos.union nut with compression ring: 20 sets.lead gasket g100: 40nos.make: chloro controltonner valve cap nut with blind lead gasket: 01 no. make: chloro control/capco/capital control, overhauling of chlorinator includingchanging of back body panel and inlet capsule assembly with yoke assembly suitable for cylinder/filter mounted chlorinator and repla cement of body screws, clamp, o-rings, etc as required, diaphragm bolt assembly for chlorinatorcomplete set

Ferric Chloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

Corporations And Associations And Others

Central Government/Public Sector