Web Analytics Made Easy - StatCounter

Foot Brake Spares Tenders

Get complete information related to latest Foot Brake Spares Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Foot Brake Spares Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Foot Brake Spares Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39846548 Due date: 07 Apr, 202507 Apr, 2025 17.73 Lacs
Tender For supply of fluid coupling complete t-12 07 part no- t1207 , fusible plug with o ring part no- t12121112 , base plug part no- t121210 , flexible disk part no- t121218 , fx nut bolt and washer part no- t1212202122 , repair kit for fluid coupling t-12-12 part no- t121230323948 , coller bolt nut and washer part no- t1212404142 , driving bolt nut and washer part no- t121243444546 , driving plate part no- 5 , fusible plug part no- t120611 , plug o ring part no- t120612 , fxi part no- t120617 , flexible disc part no- t120618 , fx bolt nut and washer for fluid coupling part no- 202122 , repair kit for fluid coupling t-12-06 part no- 30323948 , driving plate for fluid coupling t-12-07 part no- t12075 , base plug part no- t120710 , fusible plug part no- t120711 , plug o ring part no- t120712 , flexible disc for fluid coupling t-12-07 part no- t120718 , spherical bush for fluid coupling t-12-0 part no- t120719 , fx nut bolt and washer part no- t1207212223 , fxo nut bolt and washer part no- t120740 , repair kit t-12 or 07 part no- t120730323948 , is bolt and washer part no- t12075051

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39834887 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For tender for supply of element assy ( inner) , valve evacuator , hose feed pump valve port 3 , bolt joint , v belt ( c x 72) , centrifugal oil filter assy , o ring housing , crankshaft , screw , clamp , pipe , exhause , bolt , hose , hose , seal , pump , fuel injection (mico) , cartidge , cartridge fuel filter , nipple , valve assy , solenoidswitch (37s) , drive assembly , turbocharger assy(tel) , thermostat , hose , water separator , bushing rubber , bolt , knob , governor assy , bearing , disc , screw , nut , rod , strainer , strainer , valve drain , hose , cap assy (vandalism) , o ring , seal oil , o ring , strainer , hose , hose , hose , o ring , gasket , screen , disc , plate , lock , guide , coller , seal oil , gasket , ring snap , lock , cover , o ring , gasket , knob , knob , hose , hose , hose , clamp , clamp , universal joint assy , tube , o ring , o ring , seal oil , seal , o ring , o ring , key , gear (driven forward) , gear driven reverse , gear (driven reverse) , gear coupling (5m) , gear coupling (6mm) , collar , bushing , spacer , bearing roller , plunger interlock , seal oil , gasket , key , cover , bearing needle , lever change , seal oil , o ring , seal ring assy , seal ring assy , o ring , o ring , bolt , ring seal , ring seal , nut , bolt reamer , bearing taper roller , tube , ring seal , disc , seal bearing , spring , rod , pin , lining brake , seal bearing , spring , spring , bearing , tube , tube , magnet , screen , o ring , o ring , hose , hose , hose , clamp , clamp , seal , cover lh , seat grease filler , seal , gasket , gasket , ring back up , cylinder , plug grease discharge , seal ring assy , nut , spacer , guard inner lh , pin master , seal dust master , pad rubber , pin assy , grommet , net , cover (lm) , cover(lm) , cover (lm) , cover assy , board floor , board floor , board floor , board floor , board floor , seat assy , hydraulic pump assy , strainer , seal oil , cap , o ring , element filter , o ring , o ring , seal bearing , seal kit , rod , bushing spherical , snap ring , o ring , o ring , bushing , o ring , hose , hose , flange , tube , bolt , pin and chain (lm) , pin , pin , washer spring , angle blade , cable tachohourmeter , switch temperature , horn , battery relay , terminal negative , water temp gauge , charge lamp , hose assy , tacho hour meter , dash lamp , eng oil pr gauge , switch starting , lamp indicator , lamp indicator eop , switch light

CTN :39835449 Due date: 16 Apr, 202516 Apr, 2025 31.0 Thousand
Tender For supply of pump water , cross disc , clutch plate , hub seal , cross universal joint

CTN :39835278 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For tender for supply of reciprocating pump spares - plate protction , seal mech , lobe liner , plate protn cover , plate protn casing , liner casing , bush sh , oring cover , oring rh bush , o-ring sh bush , ring inner , ring inner , bush rh , bush sh , plate prot , seal lip , seal lip , sleeve shaft , disc cover , base clamp , wedge clamp , wedge clamp , seal lip s15022 , rotor , seal lip , screw cap hex

CTN :39337213 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For bid to ras proc of bd50 chassis spares - cfw0112472 160202472 washer spring , cln0110000 702000000 fitting grease , 110fd11024 bolt reamer , chs0113048 700003048 o ring , 07260 02013 hose , cfw0111236 160211236 washer spring , cet0402160 bty terminal negative , 113hm01002 pump assy , 110tf02186 1303042221 guard track inner lh , 110hc01013 cylinder assy rh , 113ad11853 nut , 110tfb0046 1313000271 front idler assy , 110mc12088 1703312360 spring inertia brake lever , chs0113032 700003032 o ring , 110uj51033 1311046190 bolt cross pin , 110tf02137 1413016103 track roller assy sf , cpl0313620 704403620 plug drain , 110tf02145 1413016203 track roller assy df , bfb1311657 1303211212 bolt shoe , 110tf11233 1413014180 piston recoil spring , 110cs02052 1312100230 steering clutch assy , cfb0222010 bolt , 110tf02194 1303042230 guard track outer rh , 110mc02019 1311011110 disc main clutch , cew0342603 cable assy , 110eg02104 lamp assembly , 110ad11104 edge cutting , 110ad11112 102200002930 edge cutting , cfb0721440 bolt , cfs0131225 104031255 screw , cfw0211020 164011016 washer , 130ip91037 tacho hour meter , cfs0131640 104031640 screw , 110fd02009 gear and pinion set , cfb2711045 bolt , chh1101008 hose , 110sk01006 main clutch service kit , 110sk01055 steering case cover service kit , cfs0131230 screw , cfs0131235 104031235 screw , 110 os 02082 940010000 seat operators , 110ad52075 shaft centre , 110ad12109 collar , 110ec91146 strainer , 110sk01022 steering clutch service kit , bfn2711624 nut shoe , cfs0130816 100030816 bolt , 110mc11618 plate lock , cfp02 11025 pin , cfb0721450 104031450 bolt , 110 ct 11062 bushing master , chs01 15260 o ring , 110 tm 92561 seal oil , 110tm31113 1311442520 bracket , 110 tf 03214 rod , 110 hm 01057 hydraulic pump assy , 110 tf 11696 collar , 110 tf 11411 bolt , bfb35 11205 bolt cutting edge , 113tf13107 1413014140 lock , cfb07 21840 bolt , cfb01 21675 bolt , 110mc11359 1311011120 plate main clutch , 110tfb0079 1313000311 carrier roller assy , 110hc01005 cylinder assy lh , 110mc31366 1311011131 plate main clutch , 110fd31137 1312742130 sprocket , 110mc02124 1311000240 inertia brake assy , 110tm01005 1301400217 transmission assy , 113ad51049 1407011180 bit end rh , 110uj01007 1311046101 universal joint assy , 110 mc91144 701210085 seal oil , 110ec00109 1300300212 radiator assy , chs0710090 seal oil , 110ct01001 track shoe assy , 110 mc 51665 gear main clutch , 110tm02018 gear box assy , 110tm02026 1301400220 gear shift lever assy , 110cs02069 case and frame assy , 116adb0028 1547000033 angle blade assy , 116tfb0027 1543000203 track frame assy rh , 116adb0069 1547000041 c frame assy , 116ad02046 1547011113 blade cutting , 116ad02021 1547013170 c frame , 116cs02114 1542100134 steering clutch assy , 116ec02026 1500301003 radiator assy , 116fd31329 1542712212 sprocket , 116tfb0076 1543000122 recoil spring and cylinder assy , 116tf02004 1503022115 idler front , 116hs01005 1546011003 hydraulic tank assy , 116fd31345 1542712331 support sprocket

Central Government/Public Sector

CTN :39816476 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For supply of bearing part no.245261 suitable for dana-spicer make transmission assy model no t-12000 , disc outer part no.245238 suitable for dana-spicer make transmission assy model no t-12000 , disc inner part no.245239 suitable for dana-spicer make transmission assy model no t-12000 , charge pump assy part no.246495 or 4212354 suitable for dana-spicer make transmission assy model no t-12000 , sleeve part no.246501 suitable for dana-spicer make transmission assy model no t-12000 , ring part no.230416 suitable for dana-spicer make transmission assy model no t-12000 , snap ring part no.245255 suitable for dana-spicer make transmission assy model no t-12000 , piston part no.4203230 suitable for dana-spicer make transmission assy model no t- 12000 , seal part no.244841 suitable for dana-spicer make transmission assy model no t-12000 , seal part no.244128 suitable for dana-spicer make transmission assy model no t-12000 , kit drive plate part no.802427 suitable for dana-spicer make transmission assy model no t-12000 , flange part no.4204895 suitable for dana- spicer make transmission assy model no t-12000 , bearing part no.225825 suitable for dana-spicer make transmission assy model no t-12000 , flange part no.246610 suitable for dana-spicer make transmission assy model no t-12000 , ring part no.246605 suitable for dana-spicer make transmission assy model no t-12000 , gasket part no.4201488 suitable for dana-spicer make transmission assy model no t-12000 , solenoid part no.4210504 suitable for dana-spicer make transmission assy model no t-12000 , gasket part no.4201489 suitable for dana-spicer make transmission assy model no t- 12000

corporations/Associations/Others

CTN :39838344 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For auction sale of blanket,clutch pressure plate,electronic scrap,fire ext o/s,helmet os,mt scrap,net mosquito,tent o/s,tyre o/s,web eqpt and text misc,tyre o/s,boot dms,ms scrap,cordags of sorts,clothing o/s,wheel disc,canvas scrap,plastic scrap,rubber scrap,cwp o/s,tarpaulin old,electric scrap

corporations/Associations/Others

CTN :39355172 Due date: 02 Apr, 202502 Apr, 2025 11.87 Crore
Tender For corrigendum : procurement of clutch and clutch parts - clutch disc 330 dia - eic bsiii, clutch disc14 8 coil sprg bsiii leyland, assy clutch booster 90dia - tt bsiv, clutch operating lever - ll bsiv, major repair kit ng-8 - ll bsvi, clutch disc - eic bsiv, operating lever clutch control - ll bsvi, clutch release yoke jn nurm - tt bsiii, clutch releaser bearing assy - tt bsvi, clutch cover assy - tt bsvi-272425400267, clutch disc - tt bsvi-272425200215, releaser bearing clutch control 380 dia - ll bsvi, clutch releaser bearing assy 380 dia 65 gb - ll bsvi, clutch disc 380 dia organic - ll bsvi, cover clutch 380 dia diaphragm - ll bsvi, clutch releaser bearing midi - ll bsiv, release lever with eye bolt 352 dia - tt bsiv, clutch operating lever 4 f - ll bsiii/iv, clutch release bearing midi - ll bsiii/ iv, clutch socket leyland - ll bsiii/ iv, clutch housing needle bush - eic bsiii, clutch housing - eic bsiii, clutch release lever - tt bsiii/ iv, clutch lever with eye bolt - tt bsiii/ iv, pressure plate service kit - tt bsiii/ iv, clutch disc assy 380 dia - tt bsiii/ iv, clutch disc midi - ll bsiv, pressure plate assy midi - ll bsiii/iv, c r bearing assy 1512 - tt bsiv, clutch facing dia 395 - eic bsiv, assy clutch pipe - eic bsiv, bearing clutch release shaft - eic bsiv, assy clutch release shaft - eic bsiv, assy clutch disc - eic bsiii, clutch release bearing assy - eic bsiii/ iv, clutch pedal return spring - eic bsiii, clutch release bearing - ll bsiii/ iv, clutch release bearing - tt bsiv, clutch release fork - tt bsiv, clutch disc - ll bsiii/iv, kit for assy clutch cover 395 - eic bsiv, clutch booster kit - eic bsiii, assy clutch release shaft - eic bsiii, shaft clutch release rh - eic bsiii, lever service kit - eic bsiii, release lever service kit - tt bsiii/ iv/ vi, clutch spring kit 380 dia - tt bsiii/ iv/ vi, clutch disc assy 1.75mm - eic bsiii, collector ring kit - eic bsiii, clutch fork - eic bsiv, release lever service kit - eic bsiv, clutch pressure plate - eic bsiv, clutch pressure spring kit - eic bsiv, clutch boster 4 inch - eic bsiii, clutch pressure plate - eic bsiii, clutch fork rod - eic bsiii, clutch repair spring kit - eic bsiii, clutch eye bolt kit major - eic bsiii, clutch cover assy 352 dia - eic bsiii, m c pipe - tt bsiii/ iv, clutch cover - eic bsiv, clutch disc - eic bsiv., clutch collector ring - tt bsiii/ iv/ vi, clutch cover assy (1.75 spline) 380 dia - tt bsiii/ iv, clutch disc assy (1.75 spline) 380 dia - tt bsiii/ iv, clutch cover assy 330 dia - tt bsiii/ iv, clutch release bearing assy - tt bsiv, clutch booster lit midi - ll bsiv, minor kit 4 finger - ll bsiii/ iv, clucth rep kit major 4f - ll bsiii, clutch pin & bush kit (3 pin 3 bush) - ll bsiii/ iv, clutch w/d plate 14 inch 4 fing hyd act - ll bsiii, clutch face plate 4 f - ll bsiii/ iv, retainer spring 4 f - ll bsiii/ iv, clutch spring kit 4 finger - ll bsiii/ iv, clutch withdrawal sleeve - ll bsiii/iv, clutch rod socket assy - ll bsiii/ iv, clutch withdrawal sleeve 4 finger - ll bsiii, clutch back plate 4f - ll bsiii/iv, clutch pressure pad 1st o/s - ll bsiii/ iv, clutch pressure pad std - ll bsiii/ iv, clutch lever 14 inch 4 finger - ll bsiii, bearing housing 4f- ll bsiii/iv, clutch releaser bearing cover - ll bsiii, clutch operating pin (9227z406) - ll bsiii/iv, clutch disc 14 inch - ll bsiii, clutch disc 14 inch round ceramic type - ll bsiii, clutch disc 14 inch - ll bsiii., clutch disc 14 inch ceramic star type - ll bsiii, s/a of ret spg 4 fng - ll bsiii/ iv, s/a clutch withdrawal plate 4 finger - ll bsiii/ iv, clutch cover assy 14 inch 4 fng - ll bsiii, clutch cover assy - ll bsiii, clutch disc 14 inch 4 finger (with 8 coil spring) - ll bsiii, assly.clutch release bearing - tt bsiii, pressure spring kit - tt bsiii/ iv, clutch cover repair kit - tt bsiv, pressure plate with needle roller bearing - tt bsiv, clutch cover assy - tt bsiv, clutch disc - tt bsiv, return spring clutch control - tt bsiii/ iv, clutch disc 330 dia (organic)

Central Government/Public Sector

CTN :39541751 Due date: 26 Mar, 202526 Mar, 2025 NA
Location: Goa - Goa Goa - Goa
Tender For corrigendum : supply of ms cutting disc pno-2608600277 chopsaw 14" x 3mm samurai (d/f) , chalk stick hard marking plate
 Loading, Please wait...

Connect us via What's Up