Latest fructose Tenders | Government fructose Tenders

CTN :39995352

18 Apr, 2025 1.26 Lacs

Ramdurg - Karnataka

Tender For supply of science labratory items for govt. high school in sunnal village of ramdurg taluk. - office almirah 2 door file cabinet (size 6 feet height 3 feet width 1.5 feet deep, gray paint coated, 5 shelves with designed for maximum space utilization to organize stuff systematically made of 22 gauge steel., human excretory system-lab, beakers borocilicate glass material 250ml (set of 2 ), ball and stick kit for carbon and its compounds ( ontains- 220 pieces. organic/chemical bonding / inorganic / stereo chemistry /coordination compounds models can.be made using colored atoms, flexible & rigid connectors for ex. alkane, alkene, alkyne, bent shapes, bidentate ligand), lab item - human digestive system, lab item - respiratory system of human , flower model, calcium oxide 500gm, male reprodcutive system model anatomical , female reproductive systenm model, human kidney model & anatomically, digital therometer standard size , thermometer 0 to 360, filter funnel standard size borocilicate glass, conical flask borocilicate glass material 100 ml, spirit 500 ml, test tube rack for 6 tubes of 15 ml , tripod stand standard size with wire gauge, lab item - spatula ss 5 inches long (set of 5), burette with stand and clamp standard size iron base with 3 ft rod bosh 3 clamps and bosh head (set of 1), dropper 20cm long (set of 10), testube 15 x 125mm borocilicate glass (set of 6), rubber cork standard size (set of 10), merthyl orange (100 ml), phenolphthalein solutlon (500 ml), potassium hydroxide (500 gm), plant cell standard size(material made of fiber glass), animal cell model standard slze (materlal made of fiber glass), methaline blue (125 ml), coverslip 22 x 22 (1 box 100 piece), plane slide 75mm x 25mnm (1 box 50 piece) , micoscope with 2 eyes pieces & 2 object depth 6cm (objectlve 10x and 40x) wlth 25 slides, bell jar with vaccum (8 inch hleght, 4 inch dimensions), prism made of transperent glass material stadnard size (30+30mm), lab item - glass slab 18mm (size 75 x 50 x 18 mm), concave & convex mirror 50mm & 15cm length (set of 2+2) , lens stand v shape edge wooden material (set of 6), rubber sucker, comapass standard size (3 inch daimeter), meter scale ss 60 cm, electro magnet-u shape iron with copper winding at both end, u shape magnet (standard size2 inch), bar magnet (3 inch)pair , lead nitrate (500 gm), iodine (500 ml), potassium permanganate (500gm)n10, sulphur powder (500 gm) labroratory reagent grade, filter paper standard size 100 leaves(12.5cmx100 pc), ph paper pkt of 200 leaves(6cmx1cm), litmus paper red & blue combo pack of 100 blue and 100 red litmus paper

CTN :39724420

18 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For corrigendum : supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), sto

CTN :39914765

17 Apr, 2025 2.26 Lacs

Multi City - Karnataka

Tender For supply of science labratory items for khps chikka ulligeri,khps hire ulligeri and khps inamhongal.-pkg-5 - litmus paper red & blue combo pack of 100 blue and 100 red litmus paper,, ph paper pkt of 200 leaves(6cmx1cm), filter paper standard size 100 leaves(12.5cmx100 pc), sulphur powder (500 gm) labroratory reagent grade, potassium permanganate (500gm)n10, iodine (500 ml), lead nitrate (500 gm), bar magnet (3 inch)pair , u shape magnet (standard size2 inch), electro magnet-u shape iron with copper winding at both end, meter scale ss 60 cm, comapass standard size (3 inch daimeter), rubber sucker, lens stand v shape edge wooden material (set of 6), concave & convex mirror 50mm & 15cm length (set of 2+2) , lab item - glass slab 18mm (size 75 x 50 x 18 mm), prism made of transperent glass material stadnard size (30+30mm), bell jar with vaccum (8 inch hleght, 4 inch dimensions), micoscope with 2 eyes pieces & 2 object depth 6cm (objectlve 10x and 40x) wlth 25 slides, plane slide 75mm x 25mnm (1 box 50 piece) , coverslip 22 x 22 (1 box 100 piece), methaline blue (125 ml), animal cell model standard slze (materlal made of fiber glass), plant cell standard size(material made of fiber glass), potassium hydroxide (500 gm), phenolphthalein solutlon (500 ml), merthyl orange (100 ml), rubber cork standard size (set of 10), testube 15 x 125mm borocilicate glass (set of 6), dropper 20cm long (set of 10), burette with stand and clamp standard size iron base with 3 ft rod bosh 3 clamps and bosh head (set of 1), lab item - spatula ss 5 inches long (set of 5), tripod stand standard size with wire gauge, test tube rack for 6 tubes of 15 ml , spirit 500 ml, conical flask borocilicate glass material 100 ml, filter funnel standard size borocilicate glass, thermometer 0 to 360, digital therometer standard size , human kidney model & anatomically, female reproductive systenm model, male reprodcutive system model anatomical , calcium oxide 500gm, flower model, lab item - respiratory system of human , lab item - human digestive system, ball and stick kit for carbon and its compounds ( ontains- 220 pieces. organic/chemical bonding / inorganic / stereo chemistry /coordination compounds models can.be made using colored atoms, flexible & rigid connectors for ex. alkane, alkene, alkyne, bent shapes, bidentate ligand), beakers borocilicate glass material 250ml (set of 2 ), human excretory system-lab

State Government

CTN :39932244

25 Apr, 2025 NA

Rupnagar - Punjab

Tender For urchase of lab multipal items and chaff cutter - triss buffer (sigma t1378 7-9 ), citric acid monohydrate (merck cat.1.93011.0521), d.fructose (merck cat. 1.94905.0251d), glycerol anhydrous emperta (merck cat.1.07051.0521), lobolene (non spermcidal) ( ar grade), silvicide, formaldehyde solution (ar grade), ethanol (ar grade), methanol (ar grade), kmno4 (ar grade), savlon, filter paper no.1 (size 125 mm) (whatman), aluminium foil size 72 mtr., disposable hand gloves (medium size), tips disposable (microtips disposable) (2-200ul), tissue paper for lab use, flask 100 ml (conical flask- borosil), flask 150 ml (conical flask- borosil), glass slides (blue star), cover slips (blue star), chaff cutter

State Government

CTN :39200933

19 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39481968

09 May, 2025 NA

Dehradun - Uttarakhand

Tender For corrigendum : supply of chemicals and surgical consumable articles - acriflavine (bp), bleaching powder (ip), boric acid (i.p./b.p.), copper sulphate (i.p.), crystal violet (bp), gentian violet (bp), magnesium sulphate (i.p./b.p), potassium permanganate (i.p.), soda bicarb (i.p./b.p), silver nitrate, castor oil ip (medicinal grade), tr. benzoin co.(i.p. ), turpentine oil (i.p.), tr. iodine (i.p.), glycerine (i.p.), hydrogen peroxide, liquid paraffin (i.p.), phenyle r.w.c.010 (grade02) 5 lit. (i.s.i.), formaline 40% (40% sol. of formaldehyde), hand sanitizer, liquid soap, spirit, cryo vials (4.5 ml), thermometers (both centigrade and fahrenheit ), cotton absorbant (i.p.), bandage cloth, rolled bandage, disposable caps, protective glasses, disposable gloves, disposable shoe covers, face mask disposable (100 pack), ppe kit for direct handler (standard), disposable needle 18 gauze x 1.5" isi, disposable syringes with needle(18 gauze) isi (10ml), disposable syringes with needle(20 gauze) isi (5 ml), disposable syringes with needle(24 gauze) isi (2 ml)

CTN :39530511

15 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various chemicals and fine chemicals, at skims, soura, srinagar on one year rate contract basis. - item specifications, 2-mercaptoethanol, absolute alcohol 99%, acetic acid, acetic acid glacial, acetone, acid fuchsin, acrylamide, alpha naphthol, alpha naphthylamine, ammonium acetate, ammonium chloride, ammonium persulphate, amyl alcohol, basic fuchsin, bis-acrylamide, bismark brown (powder), boric acid, bromophenol blue, calcium chloride, calcofluor white, carbol fuchsin (zn, strong), chloroform, conc. hydrochloric acid (hcl), conductive electrode paste/eeg paste, copper sulphate, crystal violet, diethyl pyrocarbonate (depc), dimethyl formamide, dimethyl sulfoxide (dmso), dimethyl-p-phenylene diamine dihydrogen chloride, dipotassium hydrogen phosphate, disodium edta, disodium hydrogen phosphate, dpc, dpx, edta dipotassium salt, eosin liquid, eosin powder, eosin y, ethanol 99%, ethedium bromide (etbr), ethyl alcohol, formaldehyde 37%, formic acid 85%, fungizone, giemsa stain, glycerol glycerin 98%, haematoxylin harris, hematoxylin (liquid), hematoxylin (powder), hydrochloric acid (98%), hydrogen peroxide (30%), hypochlorite solution (4%), iodine, isoamyl alcohol, isopropyl alcohol 99%, l pyrrolidonyl-b-naphthylamide, laboratory detergent, leishman s stain, liquid ammonia, lithium powder, magnesium chloride, magnesium citrate, magnesium sulphate, may grunwald stain (powder), mercuric oxide powder, methanol 99%, methyl red (powdered), methylated spirit, methylene blue (powdered), medical grade soda lime with following specifications: 1. should have high absorption capacity for carbon dioxide (more than 100 ltr/kg)2. should have low dust level.3. granule size 2.5-5.0 mm4. indicator pink to white., n acetyl l cysteine, n,n, dimethyl formamide, nigrosin, nitric acid 72%, para dimethyl amino benzaldehyde, para-dimethyl amino cinnamaldehyde, parafin oil (liquid), periodic acid, phenol, phenol (tris saturated), phosphate buffer saline capsules/tablets, potassium acetate, potassium bicarbonate, potassium chloride, potassium dichromate, potassium dihydrogen orthophosphllate, potassium dihydrogen phosphate na2hpo4, potassium ferro cyanide k4fe(cn), potassium hydroxide, potassium iodide, potassium permanganate, silver nitrate, skin preparation gel, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium deoxycholate, sodium dihydrogen orthophosphate, sodium dihydrogen phosphate, sodium dodecyl sulphate (sds), sodium hippurate, sodium hydroxide, sodium hypochlorite, sodium taurocholate, sucrose, sulfanilic acid, sulphuric acid, tetramethyl-p-phenylene diamine dihydrogen chloride, toluidine blue (powder), tris, tris hcl, urea (nh3conh2), xylene 98%

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

Fructose Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

Central Government/Public Sector

corporations/Associations/Others