Tender For supply of ketamine hcl 50 mg per ml 2 ml inj , vitamin b complex with a minimum concentration of vit b1 5mg vit b6 3mg and vit b12 5mcg therapeutic tab cap , diclofenac sr 100 mg tab , tab pramipexole 0 point 25 mg , povidone iodine solution 5 percent bottle of 100 ml , tab epleronone 25 mg , tab olanzapine 10mg , syp multivitamin drops with constituents having vit a vit b1 b2 b6 vit c vit d bottle of 15ml osages as per recommended daily allowances , tab rosuvastatin 20 mg , diclofenac diethylamine 2 point 32 percent spray for tofical use , inj phytomenadione vit k 1 mg per 0 point 5 ml , inj esmolol 100 mg 10ml , tab rabeprazole 20 mg , inj benzathine penicillin i p 600000 i u , tab trimetazidine mr 35 mg , tab etoricoxib 120 mg , tab indomethacin 75 mg sr tab , tab ketorolac 10mg tab , tab tramadol hcl 50 mg , succinylchloline chloride 50 mg per ml 2 ml inj , tab dexamethasone 0 point 5 mg , inj pralidoxine 500 mg per 20ml , tab clofazimine 100mg , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , tab trihexyphenidyl hcl 2 mg , tab ethamsylate 250mg , gamma benzene hexachloride 1 percent w by v cetrimide 0 point 1 percent w by v in alcoholic solution , ciprofloxacin hcl 0 point 3 perent plus dexamethasone 0 point 1 percent bott of 5ml , tab glyceryl trinitrate cr 2 point 6 mg , tab thyroxine sodium 75 mcg , tab voglibose 0 point 3 mg , tab digoxin 0 point 25 mg , tab clonidine 100mcg , bisoprolol 5 mg tab , human insulin analogue glargine inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen , tab nebivolol 50 mg , antibiotic ointment each gm containing polymyxin b sulphate 5000 units zinc bacitracin 400 units neomycin sulphate 3400 units 5gm ointment , tab minocycline 100 mg , tab paraformaldehyde , tab antispasmodic containing mefenamic acid 250 mg and dicyclomine hcl 10mg , lactic acid bacillus sachet , hydrocortisone enema 10 percent w by w , tab bisacodyi 5mg , liquid paraffin in bottle of 100 ml , misoprostrol 25 mcg tab , tab isoxsuprine 10mg , estradiol valerate 2mg tab pack of 28 , sevelamer 400mg tab , ciprofloxacin hcl 0 point 3 percent tube of 5 gm , cyclopentolate hcl 1 percent opth soln bottle of 5 ml , cream luliconazole tube of 15 gm , dexamethasone sodium phosphate 1 percent and tobramycin 0 point 3 percent w by w oint tube of 3 point 5gm , beclomethasone dipropionate nasal spray 50 mcg per dose metered dose 150 units , chlorpromazine 25mg tab , tab amisulpride 200mg , dextrose 50 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , multi vit inj iv 2 10 ml with minimum constituents having thiamine b1 30mg per ml pyridoxine b6 30mg per ml and b12 cyanocobalamin 300 mcg per ml , capsacain gel tube of 20 gm , leflunomide tab 10 mg , nitrofurantoin 100 mg tab , eye drop brimonidine 0 point 2 percent plus brinzolamide 1 percent bottle of 5 ml , inj nitroglycerine 5 mg , tab semaglutide 3 mg , tab misoprostol 200mcg , inj tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , tab natural micronised progesterone 200mg , tab esomeprazole 40 mg plus levosulpride 75 mg , salmeterol 25 mcg plus fluticasone 250 mcg autohaler bid details/ 2 / 58
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76