Icu Unit Tenders

Get complete information related to latest Icu Unit Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Icu Unit Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Icu Unit Tenders .

Filter

Loading....

Get Tender in Email

CTN :36317837

28 Jun, 2024 NA

Lucknow - Uttar Pradesh

Tender For e-tender for the supply of diagnostic kits to uttar pradesh medical supplies corporation limited

CTN :36256910

07 Jun, 2024 NA

Thane - Maharashtra

Tender For supply of medical kits - tab.procet cold, tab.crocin advance/dolo, tab.myelgesic-pm, tab.ondem/emsset, tab.ocid-20, tab.digene, tab. 1al (levocetrizine), tab.cyclopam, tab.cofsil, tab.dulcolax, tab.ridol,cap.vizylac & ors, hexigel, ciplox eye/ear drops, volini gel (10gm), band-aid

Central Government And Public Sector

CTN :36239695

14 Jun, 2024 9.08 Lacs

Mumbai - Maharashtra

Tender For supply of consumables and kits for medical research misc1 - n5751-5g l-name 5gm nw-nitro- l-arginine methyl ester hydrochloride , 1610377 precision plus protein dual xtra prestained protein standards 500ul , e-el-r0026 rat leutinizing hormone lh elisa kit 96 tests , e-el-r0391 rat follicle stimulating hormone fsh elisa kit 96 tests , e el-0154 progesterone elisa kit 96 tests , e-el-r3006 rat prolactin hormone prl elisa kit 96 kit , p034-100r salsa mlpa p034 dmd-1 probe mix 100 reactions , p035-100r salsa mlpa p035 dmd-2 probe mix 100 reactions , ek1- fam salsa mlpa ek1 reagent kit 100 reactions 6 vials 100 reactions -fam , 07j68-001 thermobrite humidity strips , a12216 amplex red cholestrol , a22189 amplex red glucose 1gu , a12221 amplex red glutamic ac , a22188 amplex red hydrogen pe , a33855 amplex red ultra red stop reagent , q32856 qubit assay tubes set of 500 , custom morpholino 5ctccagcccagtctgcccatcgag3 carboxyfluorescein 300nmol , standard control oligo - 3 fluorescein 300nmol , ek-075-40 leap-2 38-77 elisa kit , mb228-500ml , 61808 pyridine 500ml

CTN :36200330

15 May, 2024 NA

Raipur - Chhattisgarh

Tender For notice inviting tender of two year rate contract for supply of quality control kits for department of biochemistry at all india institute of medical sciences, raipur

CTN :36191187

09 May, 2024 NA

Raipur - Chhattisgarh

Tender For notice inviting tender of two year rate contract for supply of ana and elisa kits for department of biochemistry at all india institute of medical sciences, raipur

Loading, Please wait...

Icu Unit Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector