Latest laboratory chemical item Tenders | Government laboratory chemical item Tenders

Central Government/Public Sector

CTN :39846599

16 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of edicines for hospital - mg domperidone 30 mg. cap or tab. , pantaprazole 40 mg . tab. , rabiprazole 20 mg domperidone 30 mg. tab. , omeprazole 20 mg. cap , ondansetron 4 mg. tab. , calcium 500 mg. tab. , allopurinol 100 mg. tab. , febuxostat 40 mg. tab. , betahistine 8 mg. tab. , albendazole 400 mg. tab , i. v. sodium chloride 0.9 percent 500 ml , i.v. mannitol 20 percent 100ml , levolin respules 0.31 mg , budecort respules 0.5 mg , olmesartan 40mg. tablet , teneligliptin 20mg. tablet , ors 21.8gms. , i.v sodium chloride 0.9 percent 100ml. , diclofenac 50mg tablet , paracetamol 650mg tablet , dexamethasone sodium phosphate 4mg. injection 2ml. , promethazine hydrochloride 25mg injection 2ml. , lignocaine hydrochloride 2 percent injection 30ml. , lignocaine hydrochloride and adrenaline bitartrate injection 30ml. , metoclopramide hydrochloride 5mg. injection 2ml. , phenytoin sodium 50mg. injection 2ml. , dopamin hydrochloride 40mg injection 5ml. , etofylline and theophylline injection 2ml. , frusemide 10mg injection 4ml. , diphenhydramine hcl ammonium chloride sodium citrate and menthol syrup 100 ml cough syrup , paracetamol 125 mg tab , i.v dextrose 25 percent 100 ml , drotaverine hychloride 40 mg injection , ondansetron 2 mg injection , hyoscine butylbromide 20 mg injection , pantoprazole 40 mg injection , cefuroxime 500 mg tab , paracetamol injection , diazepam injection , pentazocine injection , etophylline and theophylline 150mg tablet , etophylline and theophylline 300mg tablet , hydrocortisone sodium 100 mg injection , adrenaline bitartrate injection , atropine sulphate injection , dapagliflozin 10mg , tetanus toxide 0.5 ml injection , lignocaine 2 percent jelly 30 gms , i.v electrolyte p 500 ml

CTN :39858766

18 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

Central Government/Public Sector

CTN :39562406

27 Mar, 2025 5.34 Crore

Paradip - Odisha

Tender For corrigendum : supply of "albendazole 200mg, 10 ml. bottle " , di-sodium hydrogen citrate 1.37g/5ml. pack of 100ml. , amoxicillin 200 mg,clavulanic acid-28.5 mg/5ml.bottle of 30ml , sucralfate1gm,oxetacaine 20mg/10ml. bottles of 170ml , aluminium hydroxide 200 mg,mg. hydroxide 200 mg. per 5ml sugar free liquid bottle packing of 170ml. , "dicyclomine 10mg./5ml. pack of 30ml " , "ambroxol 30mg,guaiphenesin 100 mg,terbutaline 2.5 mg/10ml syrup, bottles of 100ml. " , "dextromethorphan 10 mg ,phenylephrine 5 mg ,chlorpheniramine meleate 2mg/5ml syrup,bottles of 100ml. " , "azithromycin 200mg/5ml syrup/suspension ,bottles of 15ml. " , magnesium hydroxide 3.75 ml,liq. paraffin 1.25 ml, sodi. pico sulphate 3.33 mg bottles of 225ml. , "lactitol monohydrate 10 gm syrup/suspension pack of 200ml, " , "cetirizine 5 mg/5ml syrup/suspension bottles of 60ml." , "ondansetron 2 mg/5 ml syrup/suspension, bottles of 30ml. " , "paracetamol 250 mg/5 ml syrup/suspension, bottles of 60ml." , "montelukast 4mg, levocetrizin 2.5mg/5ml syrup/suspension bottles of 30ml." , "ambroxol 15 mg,guaifenesin 50 mg,terbutaline 1.25 mg 5ml syrup, bottles of 100-mlpadeiatric " , ofloxacin 100mg,metronidazole 200mg syrup, bottles of 60ml. , "ibuprofen 100mg,paracetamol 125mg/5ml syrup/suspension bottles of 30 ml" , "calamine and zinc oxide lotion... bottles of 100ml " , "beclomethasone dipropionate 0.025% w/w,phenylephrine hydrochloride 0.10% w/w,lignocaine hydrochloride 2.50% w/w,chlorocresol 0.1% w/w, pack of 20gm. " , povidone -iodine 2%w/v germicide gargle, pack of 100 ml bottle , chlorhexidine gluconate 0.2 %w/v mouth gargle , clotrimazole 1% w/w,beclomethasone 0.025% w/w (tube) pack of 15gm , "clindamycin 1% w/w,pack of 20gm " , "diclofenac 1.16, linseed oil -3,menthol 5,methyl salisylate 10,capsaicin 0.025...pack of 30 gm " , "diclofenac diethylammonium topical ,linseed oil topical... " , clobetasol 0.05%,miconazole 2%,tube of 15 gm packing , clobetasol 0.05%,salicylic acid 6%,tube of 30 gm packing , mometasone furoate 0.1% w/w (tube), pack of 15gm. , mometasone 0.1% w/w , fusidic acid 2% w/w (tube), pack of 10gm. , "triamcinolone acetonide 0.01 %w/w, pack of 5-10gm " , "ammonium chloride 0.5 %w/w,calcium lactate 0.5 %w/w,glycerin 3 %w/w,lactic acid 6 %w/w,magnesium chloride 0.3 %w/w,potassium chloride 0.5 %w/w,sodium chloride 0.5 %w/w,sodium dihydrogen phosphate 0.5 %w/w,urea 12 %w/w,ointment/cream " , "octinaxate,oxybenzone,zinc, avobenzone (spf 50) lotion pack of 50gm " , liquid paraffin 10.2 %w/w,white soft paraffin 13.2 %w/w gel/cream, pack of 100gm , "terbinafine 1% w/w powder, pack of 50-100gm " , "ketoconazole 2% w/w soap pack of 50-100gm " , ketoconazole shampoo 2% w/v pack of 60ml. , "itraconazole dusting powder 1% w/w, pack of 30-100gm " , luliconazole 1w cream/gel, pack of 50 gm , acyclovir 5% w/w cream, pack of 5gm , chloramphenicol 10 mg,polymycin b sulphate 10000 iu,dexamethasone 1 mg/1 gm ointment, pack of 5gm , "neomycin 3400 u,polymycin b 5000 u,bacitracin 400 u ointment, pack of 5-10gm " , chloramphenicol 10 mg,polymyxin-b 10,000 iu/1gm ointment, pack of 5gm , silver nitrate 0.2% w/w gel/cream (tube), pack of 10-30gm , silver nitrate 0.2% jar of 240 gms packing , ganciclovir 1.5mg/1gm w/w ophthalmic gel, pack of 5gm , "chlorhexidine 0.25%,metronidazole 1%/ gm gel, pack of 20-30gm " , "lignocaine 2% w/w gel (tube)with nozzle, pack of 30-60gm " , mupirocin 2% w/w ointment, pack of 5gm , "prilocaine 2.5% w/w,lidocaine 2.5% w/w oint. (tube), pack of 5gm to 30gm " , clotrimazole 1% w/v/ml lotion, pack of 15 ml , "clotrimazole 1% w/v,beclomethasone 0.025% w/v/ml lotion, pack of 15-30ml " , permethrin lotion 5% w/w, pack of 50-100ml , salbutamol 2.5mg./ml respule pack of 2.5 ml , salmeterol 25mcg,fluticasone 250mcg/puff , pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg,budesonide 200mcg/puff, pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg, budesonide 400mcg/puff, pack of 120 metered dose with dose count

CTN :39822042

27 Mar, 2025 NA

Nalbari - Assam

Tender For supply of consumables in the laboratory of swahid smriti mahavidyalaya - catheter (polyurethane epicutaneo-cave catheter -24g/2 fr, hamilton syringe 10 ul, mg/np-40 extraction buffer, polyethylene glycol viscous liquid, ammonium acetate, 100 % acetone, sucrose, methanol, tris saturated phenol, dab 3,3-diaminobenzidine tetrahydrochloride, triton x-100, polyclonal rabbit anti-cow gfap antibody, alexa fluor 488 conjugated goat anti-rabbit secondary antibody, goat serum, dapi, h2o2, manganese chloride mncl2, peroxidase hrp-labeled lectin from griffonia simplicifolia b s- isolectin b4, sodium citrate, sodium azide, milli q water, amicon 30 kda mwco filter 4 ml sample volume, p-phenylenediamine

Laboratory Chemical Item Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government

State Government

Central Government/Public Sector