Latest liquid spray Tenders | Government liquid spray Tenders

CTN :39991725

26 Apr, 2025 NA

Ratnagiri - Maharashtra

Tender For supply of furazolidine 25mg per 5 ml , syp.pheniramine maleate each 5ml , syp. calcuim with phosphate 200 ml , syp. iron folic acid 50 ml , syp.metronidazole , syp.ondansetron , syp. paracetamol 125 mg , syp.zinc sulphate or gluconate 50 ml , vitamin a concetrated solution 100 ml , hydrogen peroxide 500 ml , surgical spirit , gel diclofenac , absorbant cotton wool 100 gm roll , absorbant cotton wool 500 gm roll , absorbent surgical gauze 50cmx18 m , adhesive plaster 10 cm x 5 mtr , adhesive plaster 7.5 cm x 5 mtr , auto clave indicator tape label size 6 cm x 2.5 cm , bandage cloth 100 cm x 20 mtr , chromic catgut size 1 0 , chromic catgut with needle size 1 , disposable examination gloves , disposable non traumatic razors , disposable sterile cotton swab , disposable syringes 10 ml with needle , disposable syringes 2ml with needle , disposable syringes 5ml with needle , disposable umbilical cord clamp , elastic adhesive bandage roll of 10 cm x 4 mtr , infusion set , plastic apron , pricking lancet , rolled bandages 10 cm x 4 mtr , rolled bandages 7.5 cm x 4 mtr , scalp vein sets no.18, 21, 22, 23, 24 , kit leptospira , rapid pregnancy testing kit , dengue kit , malaria kit , hbsag kit , rpr test kit , n 10 hydochloric acid , acetic acid solution , reagents - benedicts solution , dipsticks for urine test for protein and sugar , dipsticks for urine test for 10 p , whole blood finger prick hiv rapid test , stains field a composition typically contains a combination of dyes eg eosin and methylene blue or romanowsky-type stains , stains field b typically contains a combination of basic and acidic dyes eg a mixture of eosin, methylene blue, and other romanowsky-type stains , anti abd kit , barium chloride , micropipette , yellow tips for micropipette , specimen collection bottles , plastic dropper , digital hemoglobino meter , digital hemoglobino strips , glucometer , glucometer testing strips , pre- sterilewide mouth plastic container with screw cap 20ml with label , pre- sterilewide mouth plastic container with screw cap 100ml plastic container , tourniquet , wooden spatula , slide drying rack , test tubes glass , glass rods , glass slide box of 25 slides , curtain , blood lipid test strip dry chemistry , glycohemoglobin test kit , rapid test for qualitative detection of antibodies to s typhi igm igg , buckets big plastic , bucket small plastic , dustbin blue , red , black , spirit lamp , test tube holding clamp , test tube rack , wash basin with elbow tap , cusco speculam , examination table with lithotomy position arrangement , table top centrifuge , pathological microscope binacular , lamp with stand spot examination light , sponge holding forcep 6inch , beak forcep , edta tube collection bulbs , plain tube collection bulbs , cover slip , biodegradable biomedical waste bag, yellow, colour , biodegradable biomedical waste bag, white colour , biodegradable biomedical waste bag, blue colour , biodegradable biomedical waste bag, red colour , metoprolol tablet (q2) capsule (q2) , clobazam tablets (v2) (q2) tablet (q2) , ondansetron tablet (q2) , pantoprazole injection (q2) injection (q2) , donepezil tablet (q2) , amiodarone tablets (v2) (q2) (q2)

CTN :39964853

30 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of a4 laminating self sticking envelope 50 pack of 1 , 11x5 laminating self sticking envelope 50 pack of 1 , luxor permanent highlighter pen yellow colour , cardboard ordinary files , colin glass and surface cleaner liquid spray , binding tape 2 make five star , heavy duty a4 trimmer machine with commercial metal base and 20 sheet large capacity for office , classmate notebook single line 120 pages , yellow note stick pad big size , yellow cloth , solo a4 clear holder pack of 10 , binding covers top and bottom , white board marker pen , cd r 700mb with paper cover , dvd rw 4 point 7 gb with case make sony or equivalent , cello arc 0 point 7mm mechanical pencil with lead box , ring binder file make solo model rb405 , a4 size transperent document sleeves folder 50 sheets packet , scissors , mouse pad , apsara eraser , cello ball pen blue , envelopes a3 cloth base , spring files neelgagan no 1000

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

Central Government/Public Sector

CTN :39826384

22 Apr, 2025 NA

Dibrugarh - Assam

Tender For tender for supply of surgical and consumables hospital furniture etc to assam medical college hospital dibrugarh - supply of surgicals, consumables and hospital furniture, absolute alcohol, absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip 300gm roll, adhesive tape 7.5cm x 5 mtr spool, alcohol swab, aldheyde free disinfectant, anti septic solution 1000 ml, bandage 90cm x 18mtrs,, betadin ointment tube/nanz/ collapsible tube, betadin solution 500ml (5%), bleaching powder, cannula fixer, cidex solution 2.45% 1000 ml, collagen sheets 10 x 10cm, cotton crepe bandage b.p. size: 4mtr x 6 cm, cotton roll 500gm, disinfection solution 5 ltrs jar, elastic adhesive bandage 10cm x 1mtr, formalin, gauge cloth 90cm x 18mtr, gauge swab non sterilized, gauge swab sterilized, glycerol, hand sanitizer, hand wash 500ml bottle/, hydrogen peroxide, hypoallergenic non-woven tape, size: 5m x 2.5cm, hypoallergenic non-woven tape, size: 5m x 5cm, lysol, mackintosh sheet, methylated spirit 1 ltr jar, micro-porous plaster size: small/each box, micro-porous plaster size: big/each box, paper adhesive size: 1" x 9.0 mts, paraffin gauge dressing b.p. size: 10cm x 10cm, phenyl 450 ml bottle, phenyl solid, plaster of paris bandages bp size: 15cm x 2.7 mts, plaster of paris bandages bp size: 10cm x 2.7 mts, raxin sheet, rectified spirit 450ml, roll bandage 10cm x 5mtrs, rolled bandage 5cm x 5mtrs, 100gm/doz, rolled bandage 5cm x 5mtrs, 60gm/doz, savlon, senitary napkin, sodalime 5kg jar, surgical gauge pad, back rest, bed side screen 4 fold, biomedical waste bin trolley, door screen white, size: 200cm x 114cm/, dressing trolley, dressing trolley big size, ecg trolley, foot step (double step), foot step (single step), fowler bed (deluxe), hygiene trolley, icu bed (fowler), icu bed (mannual), icu bed with remort control, instrument trolley, instrumet cabinet, medicine cabinet, medicine trolley, mosquito stand, orthopedic bed, oxygen cylinder carrying trolley, oxygen cylinder trolley (d-type) 140cm hight tubular ms frame work fitted with wheel 125mm dia., patient carrying trolley, patient examination bed, patient examination couch, patient examination table, pediatric bed, revolving stool, revolving stool ss, saline warmer, semi fowler bed, semi fowler bed (super) with mosquito net stand, sevotec veporiser, stretcher, stretcher on trolley, waiting chair (regular), ward bed (general), wheel chair, mosquito artery forceps, speculam, pvc pipe for central line, reservior bag for anaesthesia machine, anathesia face mask 0,1,,2,3, black rubber mask 1,2,3,4, uterine sound, towel clip, ecg paper for schiller machine model at2 per packet, ecg paper for edan machine per packet, laryngeal mask airway size 1,1.5,2,2.5, i gel size 1,1.5,2,2.5, bowl stand, sterlized drum trolley, volcellum, post vaginal well retractor, cup t removal hook, anti vaginal well retractor, cunalty, coscors self retractor, angle lip retractor, hegari dilator, theraputic paraffin wax, absolute alcohol (denaturated alcohol), absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip, 300 gm roll, adhesive tape, 7.5cm x5mtr spool, alcohol swab, aldheyde free disinfectant, all container vial ( non vaccum, non iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, etc., all container vial (vacuum, iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, z no add, k2, k3, allies tissue forceps, size: 6 , 8 , autoclave big, size:big, autoclave, size: medium, autoclave, size:small, b.p. bulb, b.p. handle stainless steel, size: 3, b.p. handle stainless steel, size: 4, bandage cloth, size:90cm x 18mtrs, 325gm, barium sulphate 5 kg jar, bed pan, betadin solution 500ml (5%), bleaching powder, blood administration set disposable sterilized, bp blade, size: 11,15,20,21,22,23,24, bp instrument stand type, bp instrument (mercurial) table model, b.p instrument (digital), cannula (3 way), cap (disposable), carbon di oxide b-type cylinder (as per latest iso s

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39835465

16 Apr, 2025 NA

Visakhapatnam - Andhra Pradesh

Tender For procurement of ars items - brown sheet laminated , boom country , biodegradable polythene film length 112 width 18 thk 0.007inch , battery aa 1 v , bag gunny , bag biodegradable for garbage , aqua bond , antirust spray , abrasive paper 230x280mm , abrasive cleaning pad scrabber pad , cloth stocknite mutton cloth , cloth sponge , clip jubilee 3 , cleaning liquid for utensils , cleaning bar for utensils 500 gms , cleaner white toilet harpic , cans plastic 10 ltrs , candle wax , brush with long handle , brush sweeping hand , dust bin , door mat foot mat mat floor synthetic , distilled water , distemper white , disinfectant fluid white black phynl , detergent powder , deodriser refill for ship head , cotton waste , cotton rags , corrosion inhibitor , fiber dust brush , feather broom phooljhadu , envelope size 6 x 12 , envelope size 4 x 10 , envelope size 10 x 14 , envelope cloth coated 12 x16 , envelope cloth coated 10 x14 , envelope cloth coated 9 x12 , dvd , duster cloth , ncml solution thiourea qty for 06 month , napthalene balls , mug plastic , mosquito repellent machine with liquid , m seal , lamp clf led , jerry cans 20 ltrs , hand wash liquid , hand towel , glass cleaner 500 ml , paper napkin , paint roller9 inch , paint roller 7 inch , paint roller inch , paint roller inch , paint brush inch , paint brush inch , ncml solution teepol qty for 06 month , ncml solution phosphoric acid qty for 06 month , ncml solution oxalic acid qty for 06 month , room freshner room spray , refill for automatic air freshner , rat sticking gel , quick dry steel pully , polish metal brass , photocopier paper a3 , photocopier paper 210 x 325 mm f.s , photocopier paper 210 x 297 mm a4 , pest seal hit spray aerosole spray , pencil cell 1.5 v , tape transparent 2 , tape transparent 1 , tape insulation 25 mm steel grip , super spin mop refils , steel cleaning liquid , spray hand liquid insecticide , spin mop set , soap liquid toilet , scrubber with handle , safety gloves cloth , wonder tape 2 , wiper long handle , wet surface putty , varnish touch wood , tube flourscent led cfl , torch cell 1.5 v medium , toilet paper , telephone cable 4 core , teflon tape

Central Government/Public Sector

CTN :39810074

14 Apr, 2025 1.68 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of wonder tape 2 inch , wiper long handle , wet surface putty , varnish , tube flourecent led cfl , torch cell 1 5 v medium , toilet paper , telephone cable 4 core , teflon tape , tape trasnparent 2 inch , tape transparent 1 inch , tape insulation 25 mm steel grip , super spin mop refils , steel cleaning liquid , spray hand liquid insecticide , spin mop set , soap liquid toilet , scrubber with handle , safety gloves cloth , room freshner room spray , refil for automatic air freshner , rat sticking gel , quick dry steel putty , polish metal brass , photocoiper paper a3 , photo copier paper 210 mm x 325 mm fs , photo copier paper 210 mm x 297 mm a4 , pest seal hit spray , pencil cell 1.5 v , paper napkin , paint roller 9 inch , paint roller 7 inch , paint roller 6 inch , paint roller 4 inch , paint brush 4 inch , paint brush 2 inch , ncml solution teepol , ncml solution phosphoric acid , ncml solution oxalic acid , ncml solution thiourea , napthalene balls , mug plastics , mosquito repellent machine with liquid , m seal , lamp cfl led , jerry cans 20 ltrs , hand wash liquid , hand towel , glass cleaner 500ml , fiber dust brush , feather broom phool jhadu , envelope size 6 x 12 inch , envelope size 4 x 10 inch , envelope size 10 x 14 inch , envelope cloth coated 12 x 16 inch , envelope cloth coated 10 x 14 inch , envelope cloth coated 9 x 12 inch , dvd , duster cloth , dust bin , floor mat foot mat synthetic , distilled water , distemper white , disinfectant fluid white black phenol , detergent powder , deodriser refil for ship head 8 cm x 3 cm , cotton waste , cotton rags , corrosion inhibitor , cloth stocknite mutton cloth , cloth sponge , clip jubilee 3 inch , cleaning liquid for utensils , cleaning bar for utensils 500 gms , cleaner white toilet harpic , can plastic 10 ltrs , candle wax , brush with long handle , brush sweeping hand , brown sheet laminated , broom country , biodegradable polythene film l 112 x w 18 x thk 0.007 inch , battery aa 1.5 v , bag gunny , garbage bag biodegradable , aqua bond , antirust spray , abrasive paper 230 mm x 280 mm , abrasive cleaning pad scrabber pad

Central Government/Public Sector

CTN :39810077

14 Apr, 2025 1.67 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of consumable naval store ars items acv h 195 - wonder tape 2 inch , wiper long handle , wet surface putty , varnish , tube flourecent led cfl , torch cell 1 5 v medium , toilet paper , telephone cable 4 core , teflon tape , tape trasnparent 2 inch , tape transparent 1 inch , tape insulation 25 mm steel grip , super spin mop refils , steel cleaning liquid , spray hand liquid insecticide , spin mop set , soap liquid toilet , scrubber with handle , safety gloves cloth , room freshner room spray , refil for automatic air freshner , rat sticking gel , quick dry steel putty , polish metal brass , photocoiper paper a3 , photo copier paper 210 mm x 325 mm fs , photo copier paper 210 mm x 297 mm a4 , pest seal hit spray , pencil cell 1.5 v , paper napkin , paint roller 9 inch , paint roller 7 inch , paint roller 6 inch , paint roller 4 inch , paint brush 4 inch , paint brush 2 inch , ncml solution teepol , ncml solution phosphoric acid , ncml solution oxalic acid , ncml solution thiourea , napthalene balls , mug plastics , mosquito repellent machine with liquid , m seal , lamp cfl led , jerry cans 20 ltrs , hand wash liquid , hand towel , glass cleaner 500ml , fiber dust brush , feather brrom phool jhadu , envelope size 6 x 12 inch , envelope size 4 x 10 inch , envelope size 10 x 14 inch , envelope cloth coated 12 x 16 inch , envelope cloth coated 10 x 14 inch , envelope cloth coated 9 x 12 inch , dvd , duster cloth , dust bin , floor mat foot mat synthetic , distilled water , distemper white , disinfectant fluid white black phenol , detergent powder , deodriser refil for ship head 8 cm x 3 cm , cotton waste , cotton rags , corrosion inhibitor , cloth stocknite mutton cloth , cloth sponge , clip jubilee 3 inch , cleaning liquid for utensils , cleaning bar for utensils 500 gms , cleaner white toilet harpic , can plastic 10 ltrs , candle wax , brush with long handle , brush sweeping hand , brown sheet laminated , broom country , biodegradable polythene film l 112 x w 18 x thk 0.007 inch , battery aa 1.5 v , bag gunny , garbage bag biodegradable , aqua bond , antirust spray , abrasive paper 230 mm x 280 mm , abrasive cleaning pad scrabber pad

Central Government/Public Sector

CTN :39810104

14 Apr, 2025 1.69 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of wonder tape 2 inch , wiper long handle , wet surface putty , varnish , tube flourecent led cfl , torch cell 1 5 v medium , toilet paper , telephone cable 4 core , teflon tape , tape trasnparent 2 inch , tape transparent 1 inch , tape insulation 25 mm steel grip , super spin mop refils , steel cleaning liquid , spray hand liquid insecticide , spin mop set , soap liquid toilet , scrubber with handle , safety gloves cloth , room freshner room spray , refil for automatic air freshner , rat sticking gel , quick dry steel putty , polish metal brass , photocoiper paper a3 , photo copier paper 210 mm x 325 mm fs , photo copier paper 210 mm x 297 mm a4 , pest seal hit spray , pencil cell 1.5 v , paper napkin , paint roller 9 inch , paint roller 7 inch , paint roller 6 inch , paint roller 4 inch , paint brush 4 inch , paint brush 2 inch , ncml solution teepol , ncml solution phosphoric acid , ncml solution oxalic acid , ncml solution thiourea , napthalene balls , mug plastics , mosquito repellent machine with liquid , m seal , lamp cfl led , jerry cans 20 ltrs , hand wash liquid , hand towel , glass cleaner 500ml , fiber dust brush , feather brrom phool jhadu , envelope size 6 x 12 inch , envelope size 4 x 10 inch , envelope size 10 x 14 inch , envelope cloth coated 12 x 16 inch , envelope cloth coated 10 x 14 inch , envelope cloth coated 9 x 12 inch , dvd , duster cloth , dust bin , floor mat foot mat synthetic , distilled water , distemper white , disinfectant fluid white black phenol , detergent powder , deodriser refil for ship head 8 cm x 3 cm , cotton waste , cotton rags , corrosion inhibitor , cloth stocknite mutton cloth , cloth sponge , clip jubilee 3 inch , cleaning liquid for utensils , cleaning bar for utensils 500 gms , cleaner white toilet harpic , can plastic 10 ltrs , candle wax , brush with long handle , brush sweeping hand , brown sheet laminated , broom country , biodegradable polythene film l 112 x w 18 x thk 0.007 inch , battery aa 1.5 v , bag gunny , garbage bag biodegradable , aqua bond , antirust spray , abrasive paper 230 mm x 280 mm , abrasive cleaning pad scrabber pad

Liquid Spray Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector