Loperamide Capsule Tenders

Get complete information related to latest Loperamide Capsule Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Loperamide Capsule Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Loperamide Capsule Tenders .

Filter

Loading....

Get Tender in Email

CTN :39949198

21 Apr, 2025 NA

Asansol - West Bengal

Tender For supply of liquid antacid (aluminium hydroxide minmimum 250 mg , magnesium hydroxide minimum 250 mg , activated dimethicone 50 mg , sorbitol solution 1.25 gm per 5 ml), minimum 170 mll

CTN :39481966

09 May, 2025 NA

Dehradun - Uttarakhand

Tender For corrigendum : supply of veterinary allopathic medicines - albendazole bolus (1500 mg), albendazole bolus (3000 mg), albendazole susp. (2.5%w/v), albendazole susp. (5% w/v), albendazole + clorsulon bolus (1.25 g + 70 mg), albendazole + ivermectin bolus (1500 mg+ 100 mg), amitraz susp. (12.5% w/v), amprolium hcl + vitamin k3 (20% w/w+2mg as sodium salt), antimony pot. tartrate +ferrous sulpate +cu so4.+co cl.bolus (2gm+2gm+50mg+100mg/ bolus), atropine sulphate ip (1mg/ml ), bolus ciprofloxacin + tinidazole (1500 mg +1800 mg /bolus), benzoic acid ip 5% w/w + boric acid ip 4.5% w/w + salicyclic acid ip 3.5% w/w+ zinc oxide ip 4.5% w/w + sulphur ip 1% w/w, calcium borogluconate+ magnesium phosphate+ dextrose anhydrous (1.86% + 5% + 20%), cefuroxime sodium (250 mg/ 3.5 g syringe), cephalexin + neomycine sulph. + prednisolone (100 mg+100 mg+ 10 mg), cephalexin powder (7.5 % w/w), chloramphenicol eye ear drops (5%), chlorhexadine gulconate+cetrimide sol. (7.5%+15%w/v), cholistine sulphate powder (100 gm), ciprofloxacin + tinidazole i/u susp.(each 5 ml contains 125 mg+150 mg), clomiphene tab & copper sulphate fertility kit(500 mg clomiphene 1tab + 750 mg copper sulphate 2 tab), clorsulon + ivermectin + exipi. qs susp.(10 mg+ 10 mg /ml), closantel bolus (1gm), colistin sulphate+cloxacillin sodium (500000 iu + 200 mg), cyperheptadine hcl + cocl + vit.b1, b6, b12 (25 mg + 100 mg + 50 mg + 50 mg + 500 mg), cypermethrin high cis(12% w/v), cypremethrine high cis+ ethion solvent (12% w/v, 8% w/v qs), deltamethrin solution (1.25% w/v), dried aluminium hydroxide+ magnesium hydroxide + activated dimethicone (600 mg + 250 mg + 50 mg / 5 ml), dried aluminium hydroxide+ simethicone + sorbitol solution (70%)+ dill oil+ suspension base (600mg+300mg+400mg+100mg+50mg), enrofloxacin susp. (10%), fenbendazole + ivermectin bolus (3 g + 100 mg), fenbendazole + oxyclozanide bolus (1gm+ 800 mg), fenbendazole + rafoxanide bolus (2gm+3gm), fenbendazole bolus (1500 mg), fenbendazole bolus (3000 mg), fenbendazole susp. (10%), flumethrin solution (1%), furazolidone + metranidazole (500 mg+ 1000 mg / bolus), gamma benzene hexachloride + cetrimide+ proflavin hemisulphate+ eucalyptus oil + turpentine oil as base, gentamicin+clotrimazole+ betamethasone (0.3% w/w+1.0% w/w +0.02% w/w) eye/ ear drops, gluteraldehyde + didecyl dimethyl ammonium chloride + benzalkonium chloride ( 11.00 g + 8.18 g + 17.85 g) / 100 ml isopropyl alcohol & pine oil as excipient, hypochlorous acid (135 mg/l), inj ceftiofur sodium, inj ranitidine (50 mg/2ml) usp, inj. prednisolone acetate ip 10mg/ml, inj. ringer lactate, inj. tylosin (20%), inj. analgin (50 mg/ml), inj. amikacin sulphate (250 mg/ml), inj. amoxycillin sodium + tazobactum (3000 mg + 375 mg), inj. ampicillin (3 gm), inj. ampicillin + cloxacillin (1500 mg+ 1500 mg), inj. ampicillin+ cloxacillin (500 mg+ 500 mg), inj. b1+b2+b6+b12+ liver extract (10 mg+5 mg+100 mg+30 mcg + 0.66 ml/ ml), inj. b1+b2+b6+b12+niacinamide + d-panthenol + choline chloride ( 20 mg+ 1 mg+ 20 mg+ 200 mcg+ 20mg+ 10 mg+ 3 mg)/ ml, inj. buparvaquone (50 mg/ ml), inj. buserelin acetate (0.0042 mg/ml), inj. calcium borogluconate (25% w/v), inj. cefoparazone + tazobactum (3 g + 375 mg), inj. cefoparazone sod. + sulbactum sod. (3 g+ 1.5 g), inj. cefotaxime sod. (500 mg), inj. ceftriaxone + tazobactum (3000 mg + 375 mg), inj. ceftriaxone (3gm), inj. dextrose + sodium chloride + potasium chloride + calcium chloride + sodium lactate (20%+0.6g+0.04g+0.027g+0.312g), inj. diminazine diaceturate + phenazone (70 mg + 375 mg), inj. dinoprost tromethamine (5 mg/ ml), inj. doramectin (10 mg/ ml), inj. enrofloxacin (10%), inj. flunixin meglumine (equ. to flunixin 50 mg), inj. fortified procaine penicillin (40 lac), inj. gentamycin (40 mg/ml), inj. hydroxyprogesterone caproate (250 mg/ml), inj. isoflupredone 2mg/ml, inj. ivermectin (1% w/v), inj. levamisole hcl (75 mg/ ml ), inj. oxytetracycline (125 mg/ml), inj. oxytetracycline (50 mg/ml), inj. prostaglandin f2 (7.5%),

CTN :39873328

18 Apr, 2025 NA

Ambala - Haryana

Tender For supply of medicine - inj bleomycin sulphate 15 units vial , hydrocortisone acetate cream 1 percent ww tube of 15 gm , cap minocycline er 65 mg , tab minoxidil 2 point 5 mg , clobetasol propionate 0 point 05 percent w w plus buffered lactic acid 12 percent w w 30 gm gel , zinc oxide and benzalkonium chloride cream tube of 30 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , calcium pantothenate tablet 200 mg , lot padophyllin resin 20 percent bott of 10ml , tab acetretin 10 mg , clindamycin 1 percent w v benzoyl peroxide 5 percent w w gel 20gm , cyclophosphamide 500 mg inj , lot lactic acid 17 percent plus salicylic acid 17 percent bott of 15ml , lot ciclopirox 1 percent w v zinc pyrithidone 1 percent 100ml , cyclosporine eye drops 0 point 05 percent bott of 3 ml , ketorolac tromethamine 0 point 4 percent eye drops 5 ml , brimonidine tartrate 0 point 2 percent eye drops 5 ml , ctr nosule tension rings , microscope bulbs 15v 150w , moxifloxacin hcl 0 point 5 percent plus prednisolone 1 percent w v eye drop 5 ml , gatifloxacin hcl 0 point 3 percent plus prednisolone 1 percent w v eye drop 10 ml , malyugin ring , pva spears pkt of 10 , tropicamide 0 point 02 percent plus phenylephrine hcl 3 point 0 percent plus lidocain hcl 1 percent inj , iris hooks set of 5 , hydroxypropyl methycellulose hypermellose ups 3 gm carbomer 9802 point 2mg sorbitol dequest 2060 5slerile lubricant eye gel 10gm , fluriscein strip , acetazolamide 500mg tab , travoprost 0 point 004 percent with timolol 0 point 5 percent with polyquad 0 point 001 percent bottle with dispensing plug and screw cap eye drop bott of 2 point 5ml , tab tranexamic acid 250 mg , tab norethisterone 10mg , syp melatonin , ung betamethsone 0 point 64 mg plus salicylic acid 30 mg tube of 10 gm , syp metoclopramide 5mg ml bott of 60ml , doxepine 10mg cap , syp vitamin d3 drop 100 iu ml bott of 15ml , tab mycophenolate mofetil 750 mg , tab estradiol valerate 2mg pack of 28 , tab repaglinide 2mg , tab repaglinide 3mg , enterogermina bacillus clausii spores oral suspension 5 ml , tab estradiol hemihydrate 2 mg , syp risperidone2 ponit 5mg 5ml , tab bilastine 10 mg , ketotifen fumarate 0 point 005 percent eye drops 5 ml , atropine sulphate oint 1 percent tube of 3 gm , eye pad with patch , vitamin d3 400 iu ml drops 15ml , ether solvent , enema sodium phoshate ml 6 percent sod acid phoshate 16 percent pack of 100ml , calcium phosphate syrup 80 mg 5 ml 200 ml bottle , clotrimazole plus beclomethasone plus lignocaine plus chloramphenicol bott of 10 ml ear drop , pulv neomycin plus polymixin b bott 10gm , ung benzoyl peroxide 5 percent , tab repaglinide 1mg , inj methylcobalamine 500mcg , azithromycin 500mg inj , syp prednisolone 5 mg ml bott of 30 ml , levonorgestrel iu system , ung imiquimod 5 percent , bss ophthalmic irrigation solution 500 ml with unoport technology

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39809833

14 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of clindamycin 300 mg cap , cefixime 200 mg tab , emtricitabine 200 mg plus tenofovir 300 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300 mg plus lamivudine 150 mg plus nevirapine 200 mg tab , polyethylene glycol 400 nf 0 point 4 percent propylene glycol 0 point 3 sorbitol hp gaur borate polyquad 0 point 001 percent 10 ml bottle , pristine ns prime large 20 cm x 20 cm wipes imprengnated with normalsaline solution individually packed and gamma sterilized box of 20 wipes , cyclosporine emulsion 0 point 05 percent with glycerine caster oil polysorbate 80 carbomer 1342 preservative free aa pack of 30 vial of 0 point 4 ml each , nepafenac mocronised suspension 0 point 1 percent with bak free iit technology in packing of 5 ml , antacid chewable containing dried aluminium hydroxide ip 250 mg mag hydroxide nf 250 mg methyl polysiloxane , syp zinc 20 mg per 5 ml bottle of 100 ml , syp levosalbutamol 1 mg per 5 ml bott of 100 ml , dexamethasone 4 mg , tab methotrexate 15 mg , hepatitis b vaccine 10 ml , injectable typhoid vaccine 2 point 50 ml

Loading, Please wait...

Loperamide Capsule Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector