Lysis Buffer Tenders

Get complete information related to latest Lysis Buffer Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lysis Buffer Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lysis Buffer Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39711515

07 Apr, 2025 NA

Pune - Maharashtra

Tender For tender for supply of pre heparinized syringe with lithium heparin 3ml with safety needle , pre heparinized syringe with lithium heparin 3ml without safety needle , ployurethane tapered arterial catheter with hydrophillic coating 20g 5cm length with integrated extension tubing with introducer needle and guidewire , consumables for hhfnc device breathing circuit , consumables for hhfnc device nasal cannula , trunat dendue plus chikungunya pcr combo testwhich consist of trunat dengue plus chikungunya chip plus truepep uspt lysis buffer plus truepep uspk cartridge , polytetraflorethylene ptfe cv6 70 to 80cm 3 oblique 8 circle round body bouble needle 9 to 17mm , polytetraflorethylene ptfe cv7 70 to 80cm 3 oblique 8 circle round body bouble needle 9 to 17mm

Central Government And Public Sector

CTN :39670642

03 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of consumables - stemcell technologies sepmatea c 15 ruo 100 tubes 86420 500 tubes per pack , stemcell technologies lymphoprepa c 250ml , stemcell technologies dulbecco pbs with 2percent fbs , cell freezing medium dmso 1a , ripa lysis buffer 10 x 100ml , protease inhibitor cocktail sigma , phosstopi 1 by 2 sufficient for 10 10ml buffer preparations , np0007 nupage lds sample buffer 4x 10ml , invitrogen np0001 nupage mops sds running buffer

State Government

CTN :39372273

01 Apr, 2025 1.54 Crore

Delhi - Delhi

Tender For corrigendum : rate contract for consumable/non-consumables items for microbiology department, rajiv gandhi super speciality hospital, delhi-110093 - dehydrated media, macconkey agarw/o cv, nacl w/ 0 .5% sodium taurocholate(500g/box), brain-heart infusion base(500g/box), blood agar base(500g/box), muller hinton agar base, cation adjusted(500g/box), colistin sulfate salt(1 gram), potassium dichromate(1 kg), peptone powder(500 gram), sulphuric acid(5 ltr), cled (cystein lactose electrolyte deficient)with bromothymol blue indicator(500g/box), peptone (bacteriological) water(500g/box), chromogenic candida agar(500g/box), sabouraud dextrose agar( sda)with chloramphenicol and cycloheximide antibiotics(500g/box), sabouraud dextrose agar( sda)without antibiotics(500g/box), macconkey broth purple with bromocresol purple(500g/box), macconkey broth purple (double strength) w/ bromocresol purple(500g/box), nutrient broth(500g/box), chrom candida differential agar(100 gm), mueller hinton broth with 2 control cations(100 gm), triple sugar iron agar(500gm), simmon s citrate agar(500gm), lab consumables, whatmann filter paper no.1, nichrome loop holderloop holder made of stainless steel rod with heat resistant handle, double wound nichrome loopcalibrated to 1 l, double wound nichrome loopcalibrated to 0.01 ml, double wound nichrome straight wire for inoculation, glassware, frosted end glass slide1. 75mm 25mm 1 mm2. thickness 1.25 0.1mm(1 box=50 slides), glass slide1. 75mm 25mm 2. thickness 1.25 0.1mm(1 packet of 10 grams), cover slip1. 22mmx22mm2. thickness: 0.13mm to 0.16mm(1 packet of 10 grams), test tubes(borosilicate glass) without rim 20mm 150mm, test tubes(borosilicate glass) without rim 12mm 75mm, conical flaskgood quality, flat bottom(500 ml), conical flaskgood quality, flat bottom (1000ml), glass measuring cylinder(100ml capacity), good quality petri dishplastic, disposable, sterile 90 15mm individual packed, glass beaker(500 ml capacity), glass beaker(250 ml capacity), glass measuring cylinder(250ml capacity), glass measuring cylinder(500ml capacity), reagent, carbol fuchsin (ziehl-neelsen)(125ml), 20% h2so4,(500 ml), conc. h2so4(500 ml), acetone(500 ml), crystol violet(25 gram), immersion oil for microscopy(125 ml), potassium hydroxide pellets(500g/box), oxidase discs(50 discs), stained salmonella antigen (to, th, ah, bh) with positive and negative controls for slide agglutination test, lugol s iodine(500 ml), kovac s indole reagent(100 ml), swab, sterile cotton swab with wooden stick1. size 150 x12mm diameter.2. individually packed. , sterile cotton swabs in hdpe tube1. cotton bud with polypropylene stick2. size:150x12mm diameter tubes3. individually packed, sterile swabs1. viscose bud with wooden stick2. size 150 x2.5mm3. individually packed ( gamma sterilized), plasticware, sterile disposable loop1. sterile disposable inoculating loops (4.4 mm diameter calibrated to 0.01ml)2. individually packed, micropipette tips 2-20 l, micropipette tips 20 -200 l, micropipette tips 200-2000 l, elisa plate(50 plates), centrifuge tubes(plastic, 15 ml capacity, screw caped, graduated), microcentrifuge tubeshould be 1.5ml, sterile, polypropylene tube with screw cap.(1.5ml), aerosol barrier tips 2-20 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 20-200 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 100-1000 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., cryovialssterile self standing tight screw cap closures to prevent liquid leakage ,certified rnase/dnase free, human dna free and pyrogen free(2ml), antisera, salmonella polyvalen

State Government

CTN :39387370

26 Mar, 2025 90.00 Lacs

Delhi - Delhi

Tender For notice inviting open e-tender under rate contract for chemicals/ media items for mamc. -c001 napthyl acetate c002 10x pbs, ph-7.0 c003 10x tris-glycine sds buffer c004 10x tris-tricine sds buffer c005 2-thiobarbituric acid c006 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2h-tetrazolium bromide (mtt) c007 3,3?-diaminobenzidine (dab) c008 4-4diaminodiphenyl dihydrochloride c009 5x blot transfer buffer c010 6x loading dye for dna agarose electrophoresis c011 absolute alcohol ar c012 absolute alcohol lr c013 absolute ethanol ar c014 absolute ethanol molecular biology c015 acetic acid hplc c016 acetic acid molecular biology c017 acetone lcms/ hplc grade c018 acid fuchsin c019 acrylamide molecular grade c020 adonitol disc c021 agar powder bacteriological for use in molecular biology c022 agarose (purity sigma) molecular grade c023 agarose for molecular biology c024 alberts stain a c025 alberts stain b c026 alberts metachromatic stains kitc027 alcian blue (74240) c028 alizarin red s c029 alkaline peptone water c030 alpha-naphthylamine pure powder c031 aluminium chloride c032 aluminum sulphate c033 ammonium hydroxide ar c034 ammonium hydroxide pellets ar c035 amplitaq gold dna polymerase c036 anaerobic blood agar plate (kanamycin vancomycin laked) c037 andrades indicator c038 aniline blue (42755) c039 antibiotic powder cefiderocol c040 antibiotic powder - cyclohexamide/actidione c041 antibiotic powder amikacin sulphate (pure powder) c042 antibiotic powder amphotericin b c043 antibiotic powder aztreonam (pure powder) c044 antibiotic powder cefotaxime sodium salt (pure powder) c045 antibiotic powder ceftrixone sodium salt (pure powder) c046 antibiotic powder chloramphenicol (pure powder) c047 antibiotic powder colistin sulfate (pure powder) c048 antibiotic powder cycloheximide/ actidione c049 antibiotic powder dalbavancin (pure powder) c050 antibiotic powder daptomycin (pure powder) c051 antibiotic powder erythromycin (pure powder) c052 antibiotic powder fluconazole c053 antibiotic powder fosfomycin c054 antibiotic powder gentamicin (pure powder) c055 antibiotic powder imipenem monohydrate (pure powder) c056 antibiotic powder itraconazole c057 antibiotic powder kanamycin powder c058 antibiotic powder ketoconazole c059 antibiotic powder linezolid (pure powder) c060 antibiotic powder meropenem (pure powder) c061 antibiotic powder miconazole nitrate c062 antibiotic powder nalidixic acid (pure powder) c063 antibiotic powder netillin (netilmicin sulphate) (pure powder) c064 antibiotic powder nitrofurantoin (pure powder) c065 antibiotic powder oritavancin (pure powder) c066 antibiotic powder oxacillin (pure powder)c067 antibiotic powder penicillin-g sodium (pure powder) c068 antibiotic powder potassium clavulanate (pure powder) c069 antibiotic powder teicoplanin (pure powder) c070 antibiotic powder tetracycline hydrochloride (pure powder) c071 antibiotic powder vancomycin hydrochloride (pure powder) c072 antibiotic powder voriconazole c073 antibiotic-antimycotic c074 antimicrobial gradient strips to determine mic anidulafungin strips 0.002-32 mcg/ml c075 antimicrobial gradient strips to determine mic caspofungin strips 0.002-32 mcg/ml c076 antimicrobial gradient strips to determine mic fluconazole strips 0.002-32 mcg/ml c077 antimicrobial gradient strips to determine mic flucytosine strips 0.002-32 mcg/ml c078 antimicrobial gradient strips to determine mic itraconazole strips 0.002-32 mcg/ml c079 antimicrobial gradient strips to determine mic ketoconazole strips 0.002-32 mcg/ml c080 antimicrobial gradient strips to determine mic micafungin strips 0.002-32 mcg/ml c081 antimicrobial gradient strips to determine mic posaconazole strips 0.002-32 mcg/ml c082 antimicrobial gradient strips to determine mic voriconazole strips 0.002-32 mcg/ml c083 aprotinin molecular grade c084 arabinose disc c085 arginine hydrochloride amino acid disc c086 ascorbic acid hplc grade c087 azure ii c088 bacterial lysis buffer for dna extraction c089 bacteriode

Loading, Please wait...

Lysis Buffer Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government And Public Sector

State Government

State Government