Latest magnesite mass Tenders | Government magnesite mass Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39607700

04 Apr, 2025 NA

Morbi - Gujarat

Tender For corrigendum : laboratory items - 10 percent barium chloride solution, 100ml, 4, abatm semi auto (abacus solution), 25ml, 8, anti h lactine (tulip/span), 1 set, 12, auto pipette 10 micro fix, 1 unit, 16, auto pipette ( 10- 100 ), 1 unit, 20, autoclave electric (smallest size ), 1 unit, 24, blood sugar kit (g.o.d.p.o.d.) (span), 1 ml, 28, c.s.f.protein meter, 100 unit, 32, chikengunya rapid kit (30 test/kit), 1 ml, 36, cover slip 10 gm (22 x 22), 1 unit, 40, culture swab without jelly, 1 unit, 44, dengue (igm) antibody elisa kit (96 test/kit), 1 kit, 48, diazzo-b solution, 1 unit, 10 percent barium chloride solution, 100ml, 4, abatm semi auto (abacus solution), 25ml, 8, anti h lactine (tulip/span), 1 set, 12, auto pipette 10 micro fix, 1 unit, 16, auto pipette ( 10- 100 ), 1 unit, 20, autoclave electric (smallest size ), 1 unit, 24, blood sugar kit (g.o.d.p.o.d.) (span), 1 ml, 28, c.s.f.protein meter, 100 unit, 32, chikengunya rapid kit (30 test/kit), 1 ml, 36, cover slip 10 gm (22 x 22), 1 unit, 40, culture swab without jelly, 1 unit, 44, dengue (igm) antibody elisa kit (96 test/kit), 1 kit, 48, diazzo-b solution, 1 unit

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39826384

22 Apr, 2025 NA

Dibrugarh - Assam

Tender For tender for supply of surgical and consumables hospital furniture etc to assam medical college hospital dibrugarh - supply of surgicals, consumables and hospital furniture, absolute alcohol, absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip 300gm roll, adhesive tape 7.5cm x 5 mtr spool, alcohol swab, aldheyde free disinfectant, anti septic solution 1000 ml, bandage 90cm x 18mtrs,, betadin ointment tube/nanz/ collapsible tube, betadin solution 500ml (5%), bleaching powder, cannula fixer, cidex solution 2.45% 1000 ml, collagen sheets 10 x 10cm, cotton crepe bandage b.p. size: 4mtr x 6 cm, cotton roll 500gm, disinfection solution 5 ltrs jar, elastic adhesive bandage 10cm x 1mtr, formalin, gauge cloth 90cm x 18mtr, gauge swab non sterilized, gauge swab sterilized, glycerol, hand sanitizer, hand wash 500ml bottle/, hydrogen peroxide, hypoallergenic non-woven tape, size: 5m x 2.5cm, hypoallergenic non-woven tape, size: 5m x 5cm, lysol, mackintosh sheet, methylated spirit 1 ltr jar, micro-porous plaster size: small/each box, micro-porous plaster size: big/each box, paper adhesive size: 1" x 9.0 mts, paraffin gauge dressing b.p. size: 10cm x 10cm, phenyl 450 ml bottle, phenyl solid, plaster of paris bandages bp size: 15cm x 2.7 mts, plaster of paris bandages bp size: 10cm x 2.7 mts, raxin sheet, rectified spirit 450ml, roll bandage 10cm x 5mtrs, rolled bandage 5cm x 5mtrs, 100gm/doz, rolled bandage 5cm x 5mtrs, 60gm/doz, savlon, senitary napkin, sodalime 5kg jar, surgical gauge pad, back rest, bed side screen 4 fold, biomedical waste bin trolley, door screen white, size: 200cm x 114cm/, dressing trolley, dressing trolley big size, ecg trolley, foot step (double step), foot step (single step), fowler bed (deluxe), hygiene trolley, icu bed (fowler), icu bed (mannual), icu bed with remort control, instrument trolley, instrumet cabinet, medicine cabinet, medicine trolley, mosquito stand, orthopedic bed, oxygen cylinder carrying trolley, oxygen cylinder trolley (d-type) 140cm hight tubular ms frame work fitted with wheel 125mm dia., patient carrying trolley, patient examination bed, patient examination couch, patient examination table, pediatric bed, revolving stool, revolving stool ss, saline warmer, semi fowler bed, semi fowler bed (super) with mosquito net stand, sevotec veporiser, stretcher, stretcher on trolley, waiting chair (regular), ward bed (general), wheel chair, mosquito artery forceps, speculam, pvc pipe for central line, reservior bag for anaesthesia machine, anathesia face mask 0,1,,2,3, black rubber mask 1,2,3,4, uterine sound, towel clip, ecg paper for schiller machine model at2 per packet, ecg paper for edan machine per packet, laryngeal mask airway size 1,1.5,2,2.5, i gel size 1,1.5,2,2.5, bowl stand, sterlized drum trolley, volcellum, post vaginal well retractor, cup t removal hook, anti vaginal well retractor, cunalty, coscors self retractor, angle lip retractor, hegari dilator, theraputic paraffin wax, absolute alcohol (denaturated alcohol), absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip, 300 gm roll, adhesive tape, 7.5cm x5mtr spool, alcohol swab, aldheyde free disinfectant, all container vial ( non vaccum, non iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, etc., all container vial (vacuum, iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, z no add, k2, k3, allies tissue forceps, size: 6 , 8 , autoclave big, size:big, autoclave, size: medium, autoclave, size:small, b.p. bulb, b.p. handle stainless steel, size: 3, b.p. handle stainless steel, size: 4, bandage cloth, size:90cm x 18mtrs, 325gm, barium sulphate 5 kg jar, bed pan, betadin solution 500ml (5%), bleaching powder, blood administration set disposable sterilized, bp blade, size: 11,15,20,21,22,23,24, bp instrument stand type, bp instrument (mercurial) table model, b.p instrument (digital), cannula (3 way), cap (disposable), carbon di oxide b-type cylinder (as per latest iso s

CTN :39828784

03 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of ampicillin 10 mcg 5x50 disc catridge himidia make only , cloxacillin 5 mcg 5x50 disc catridge himidia make only , cefazolin 30 mcg 5x50 disc catridge himidia make only , cefatoxime 30 mcg 5x50 disc catridge himidia make only , cefpdoxime 30 mcg 5x50 disc catridge himidia make only , erythroumycin 15 mcg 5x50 disc catridge himidia make only , gentamycin 30 mcg 5x50 disc catridge himidia make only , nalidixic acid 30mcg 5x50 disc catridge himidia make only , ofloxacin 10 mcg 5x50 disc catridge himidia make only , amikacin 30 mcg 5x50 disc catridge himidia make only , vancomycin 30 mcg 5x50 disc catr himidia make only , tazoba/piper 10/100 mcg 5x50 disc catr himidia make only , augmentin 30 mcg 5x50 disc catridge himidia make only , cefuroxime 30 mcg 5x50 disc catridge himidia make only , lomefloxacin 10 mcg 5x50 disc catridge himidia make only , cefp/tazob10/100mcg 5x50 disc catr himidia make only , ciprofloxacin 5 mcg 5x50 disc catridge himidia make only , cephalexin 30 mcg 5x50 disc catridge himidia make only , ceftriaxone 30 mcg 5x50 disc catridge himidia make only , cotrimoxazole 25 mcg 5x50 disc catr himidia make only , nitrofurantoin 300 mcg 5x50 disc catr himidia make only , linezolid 30 mcg 5x50 disc catridge himidia make only , norfloxacin 10 mcg 5x50 disc catridge himidia make only , tetracycline 30 mcg 5x50 disc catridge himidia make only , azithromycin 15 mcg 5x50 disc catridge himidia make only , ceftazidime 30 mcg 5x50 disc catridge himidia make only , doxycycline 30 mcg 5x50 disc catridge himidia make only , levofloxacin 5 mcg 5x50 disc catridge himidia make only , meropenem 10 mcg 5x50 disc catridge himidia make only , amoxycillin 10 mcg 5x50 disc catridge himidia make only , chloramphenicol 30 mcg 5x50 disc catr himidia make only , cefixime 5 mcg 5x50 disc catridge himidia make only , penicillin 10u 5x50 disc catridge himidia make only , blood agar base 500 g. himidia make only , mac conkey agar 500gms himidia make only , glucose broth ( m860) 500g himidia make only , mueller hinton agar 500gms himidia make only , sterility testing medium a m017 500g himidia make only , agar agar ( grm 666) 500g himidia make only , robertson cooked meat medi m149 500g himidia make only , zn stain kit-himedia k005l (500 ml) , himidia make only , potassium permanganate himeda 500g himidia make only , formaldehyde solution 500ml himidia make only , inoculation loop ss4 metaloop la014 himidia make only , microtip stands (box with lid) 0-1000 l eppendorf make only , microtip stands (box with lid) 0-100 l eppendorf make only , autoclave t tube racks 30t tubes rack ria/ qualigens/ thermo fisher makes only , petri plates ria/ borosil/ sigma/ bello / abgil makes only , eto sterile swabs qualigens/ jonson/ thermo fisher/ himidia , makes only sterile containers , himidia/ borosil/ abgil makes only nutrient broth 500gms , himidia make only brain heart infusion agar 500gms , himidia make only mac conkey doub strength broth m539 500g , himidia make only fluid thioglycollate broth m009 500g , himidia make only sabouraud s dextr agar mediu mh063 500 , himidia make only anaerobic blood agar base med m1345 500 , himidia make only grams stain kit-himedia k001 (500 ml) , himidia make only lactophenol cotton blue () 125 ml , himidia make only barium chloride dehydrate 500g , himidia make only gelatin ( grm019) 500g , himidia make only nutrient agar ( m001) 500g himidia make only

Co-operative

CTN :39834125

01 Apr, 2025 47.5 Thousand

Gurgaon - Haryana

Tender For supply of lab items - 9002268, 5.000, methylene blue dye1 each contain 25 gmake-qualigen/merck, 9005388, 1.000, acetic acid1 each contain 500mlmake-qualigen/merck, 9002597, 1.000, barium chlorode1 each contain 500 gmmake-qualigen/merck, 9000601, 500.000, reagent strips for milk analysis salttotal qty : 6 each1 each - 100 stripsmake- delmos researchreagent strips for milk analysis neutralizertotal qty : 6 each1 each - 100 stripsmake- delmos researchreagent strips for milk analysis starchtotal qty : 6 each1 each - 100 stripsmake- delmos researchtotal 18 each , in which 6 ea-salt , 6 ea-neutralizer & 6 ea-starchkindly supply new manufactured stock and check the expiry date before supplying., 9002268, 20.000, chloroform1 each contain 500mlmake-qualigen/merck, 9002640, 4.000, phenol red1 each contain 25 mlmake-qualigen/merck, 9001787, 500.000

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

State Government

CTN :39600780

01 Apr, 2025 NA

Bhubaneswar - Odisha

Tender For corrigendum : tpx and barium fluoride (baf2) uv grade

Magnesite Mass Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors