Get complete information related to latest Magnesite Mass Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Magnesite Mass Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Magnesite Mass Tenders.
Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test
Tender For supply of ampicillin 10 mcg 5x50 disc catridge himidia make only , cloxacillin 5 mcg 5x50 disc catridge himidia make only , cefazolin 30 mcg 5x50 disc catridge himidia make only , cefatoxime 30 mcg 5x50 disc catridge himidia make only , cefpdoxime 30 mcg 5x50 disc catridge himidia make only , erythroumycin 15 mcg 5x50 disc catridge himidia make only , gentamycin 30 mcg 5x50 disc catridge himidia make only , nalidixic acid 30mcg 5x50 disc catridge himidia make only , ofloxacin 10 mcg 5x50 disc catridge himidia make only , amikacin 30 mcg 5x50 disc catridge himidia make only , vancomycin 30 mcg 5x50 disc catr himidia make only , tazoba/piper 10/100 mcg 5x50 disc catr himidia make only , augmentin 30 mcg 5x50 disc catridge himidia make only , cefuroxime 30 mcg 5x50 disc catridge himidia make only , lomefloxacin 10 mcg 5x50 disc catridge himidia make only , cefp/tazob10/100mcg 5x50 disc catr himidia make only , ciprofloxacin 5 mcg 5x50 disc catridge himidia make only , cephalexin 30 mcg 5x50 disc catridge himidia make only , ceftriaxone 30 mcg 5x50 disc catridge himidia make only , cotrimoxazole 25 mcg 5x50 disc catr himidia make only , nitrofurantoin 300 mcg 5x50 disc catr himidia make only , linezolid 30 mcg 5x50 disc catridge himidia make only , norfloxacin 10 mcg 5x50 disc catridge himidia make only , tetracycline 30 mcg 5x50 disc catridge himidia make only , azithromycin 15 mcg 5x50 disc catridge himidia make only , ceftazidime 30 mcg 5x50 disc catridge himidia make only , doxycycline 30 mcg 5x50 disc catridge himidia make only , levofloxacin 5 mcg 5x50 disc catridge himidia make only , meropenem 10 mcg 5x50 disc catridge himidia make only , amoxycillin 10 mcg 5x50 disc catridge himidia make only , chloramphenicol 30 mcg 5x50 disc catr himidia make only , cefixime 5 mcg 5x50 disc catridge himidia make only , penicillin 10u 5x50 disc catridge himidia make only , blood agar base 500 g. himidia make only , mac conkey agar 500gms himidia make only , glucose broth ( m860) 500g himidia make only , mueller hinton agar 500gms himidia make only , sterility testing medium a m017 500g himidia make only , agar agar ( grm 666) 500g himidia make only , robertson cooked meat medi m149 500g himidia make only , zn stain kit-himedia k005l (500 ml) , himidia make only , potassium permanganate himeda 500g himidia make only , formaldehyde solution 500ml himidia make only , inoculation loop ss4 metaloop la014 himidia make only , microtip stands (box with lid) 0-1000 l eppendorf make only , microtip stands (box with lid) 0-100 l eppendorf make only , autoclave t tube racks 30t tubes rack ria/ qualigens/ thermo fisher makes only , petri plates ria/ borosil/ sigma/ bello / abgil makes only , eto sterile swabs qualigens/ jonson/ thermo fisher/ himidia , makes only sterile containers , himidia/ borosil/ abgil makes only nutrient broth 500gms , himidia make only brain heart infusion agar 500gms , himidia make only mac conkey doub strength broth m539 500g , himidia make only fluid thioglycollate broth m009 500g , himidia make only sabouraud s dextr agar mediu mh063 500 , himidia make only anaerobic blood agar base med m1345 500 , himidia make only grams stain kit-himedia k001 (500 ml) , himidia make only lactophenol cotton blue () 125 ml , himidia make only barium chloride dehydrate 500g , himidia make only gelatin ( grm019) 500g , himidia make only nutrient agar ( m001) 500g himidia make only
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76