Web Analytics Made Easy - StatCounter

Medical Gas Reagent Strip Tenders

Get complete information related to latest Medical Gas Reagent Strip Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Medical Gas Reagent Strip Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Medical Gas Reagent Strip Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42353510 Due date: 25 Oct, 202525 Oct, 2025 NA
Tender For quotation for chemical & reagent and consumables- custom dna oligonucleotides (20-25 bp) ,agarose (500gm) ,ice box

CTN :42353515 Due date: 25 Oct, 202525 Oct, 2025 NA
Tender For quotation for chemical & reagent and consumables master mix green (100 reaction) ,diluent dna extraction (molecular biology grade (500gm) ,blood transport box

CTN :42353520 Due date: 25 Oct, 202525 Oct, 2025 NA
Tender For quotation for chemical & reagent and consumables dna purification kit(250 reaction) tae 50x (molecular biology grade (500gm) micro pipette tips (0.1-10ul)

State Government

CTN :42312003 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of dna kits and consumables c c - pop4 tm 384 catalogue no 4393715 , conditioning reagent 3500xl cat no 4393718 , cathode buffer container cat no 4408256 , anode buffer contianer cat no 4393927 , quantifiler trio cat no 4482910

CTN :42263889 Due date: 06 Nov, 202506 Nov, 2025 15.00 Lacs
Tender For supply of chemicals and reagents for mls d d - dichlorophenol indophenols , 3 2 dinitrosalicyclic acid , anthrone , ascorbic acid , infusion agar , cetrimid aga , cetrimide ar , chlorine grnules , depc treated water , diphenylamine , disodium edta , dna , edta disodium , enriched thioglycollate , hydrochloric acid , l arginine , l aspartic acid , leucine , lithium chloride , l-proline , orcinol monohydrate , oxalate , oxalic acid , phenol crystals , piperacillin , rennin , rna , rotheras , sodium carbonate , sodium hydroxide pellets , sodium laureth sulfate , stannous chloride , trisbase , 2 mercaptoethanol , sodium citrate , absolute alcohol , albert metachromatic stain kit , alpha feto protein , biuret reagent , carcino embryonic antigen , cholesterol kit , ctab extraction solution , dengue combo , dnase 1 solution , erba triglycerides , esbl , ethylene glycol , fluoride solution , follicle stimulating hormone fsh , indian ink , leutinisinghormone lh , bilirubin direct , bilirubin total , cholesterol , creatinine reagent , glucose mono reagent , hdl direct reagent , ldl direct reagent , potassium reagent , sgot reagent , sgpt reagent , triglycerides reagent , urea reagent , uric acid reagent , masson trichrome stain kit , muccarmine stain solutionotto chem , n hexane , perchloric acid , phenol chloroform , povidone- iodine solution , prolactin , prostrate specific antigen , rapid h e stain kit , rapid oil red o staining kit , pearl stain kit , ribonuclease , staining solution , siver nitratelabogen , sodium hypobromite solution , sodium hypochlorite , sulfuric acid ar , sulphuric acid ar , te buffer , testosterone , thyroid stimulating hormone , trizol reagent , universal ph indicator solution , van gieson staining kit , zn stain kit , amoxyclav , aso test kit , bacitracin disc , capsule staining kit , cefadroxil , cefepime disc , cefixime clavulanic aicd , cefotaxime disc , clavulanic acid , cefoxitin disc , cefpodoxime disc , ceftazidime , ceftriaxone disc , cephalexin , ciprofloxacin , cotrimoxazole , crp test kit , distilled water , gas pack , hav igg igm rapid test , hbsag rapid test kit , hcv ab rapid test , hcv tridot test kit , hepatitis a rapid test kit , hepatitis e rapid test kit , hev igm rapid test , hiv tridot kest kit , imipenem , nitrofurantoin , norfloxacin , novobiocin disc , ofloxacin , optochin , piperacillin tazobactem , pregnancy test kit , ra test kit , rf test kit , scrub typhus test kit , tetracycline , vdrl test kit , widal test kit

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337 Due date: 31 Oct, 202531 Oct, 2025 6.22 Lacs
Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

State Government

CTN :42250113 Due date: 01 Nov, 202501 Nov, 2025 93.00 Lacs
Tender For supply of sybr premix - tli rnas h plus , syringic acid , sinapic acid , sodium arsenate dibasic hydrate , 37 components fame mix , 2 3 5- tri phenyl tertazolium bromide , 2 4 6-tris 2-pyridyl- s-triazine , tannic acid , nnnn-tetramethyl ethylene diamine , vanilic acid , water sterile nuclease free , aflatoxin g1 , aflatoxin g2 , aflatoxin b1 , aflatoxin b2 , hemicellulase , alcalase , phytic acid assay kit , trypsin activity assay kit , 2 2-diphenyl-1-picrylhydrazyl , meta- phosphoric acid , amylose , l-amino acid assay kit , n- benzoyl-dl-arginine-p-nitroanilide bapa , trypsin - porcine pancreatic , methanol hplc grade , pancreatin , pepsin , potassium thiocyanate kscn , tannic acid standard , vanillin , tri chloro acetic acid , tris base , anthrone , hpp vessel gasket , hpp sensor probe , pectinase , cellulase , phytic acid assay kit , tannin microplate assay kit , saponin microplate assay kit , n benzoyl-dl-arginine p-nitroanilide hydrochloride , trypsin solution , phosphotungstic phophomolybdic acid , neutrase , orthophthaldehyde , 2- mercaptoethanol , l-glutathione , l-serine , ultra centrifugal filter 3 k da mwco , alpha glucosidase , ace inhibitory activity assay , indophenol dye , betacyanin , tuning and performance standards for lc ms , methyl myristate , linolenic acid methyl ester , amino acid kit , 3 5-dinitro salicylic acid reagent , p-nitrophenyl a-d-galactopyranoside , trypsin edta , acrylamide , n n-methylene bis-acrylamide , n n n n-tetramethylethylenediaamine , fluorometric , l- tyrosine , antimicrobial susceptibility test discs , mcfarland standard , phenol chloroform isoamyl alcohol , listeria monocytogenes detection kit , dna ladder 100 bp , glycine- sodium hydroxide buffer , potassium acetate , betanin , quercetin , kaempferol , 96-well polystyrene microtiter plate , indicaxanthin , 2 2-diphenyl-l-picrylhydrazyl , protein standards for electrophoresis , acarbose extrapure , tris acetate edta buffer , tris borate edta buffer , listeria monocytogenes atcc 700301 lyophilized culture , listeria monocytogenes atcc 700302 lyophilized culture , papaya mosaic virus elisa kit , papaya ringspot virus elisa kit , papaya leaf curl virus elisa kit , soybean mosaic virus elisa kit , urdbean crinkle virus elisa kit , mungbean yellow mosaic virus elisa kit , okra enation leaf curl elisa kit guide it mutation detection kit, gibson assemblycloning kit, in fusion hd cloning plus ce, monarch or genelute spin dna gel extraction kit, monarch or genelute spin plasmid miniprep kit, cathode buffer container, anode buffer container, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplc beh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfi hf, fastdigest acc65i, fastdigest maubi, 10x tris acetate boric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycine sulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2,4 dichlorophenoxyacetic acid, indole 3 acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade for lc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase , alcalase, phytic acid assay kit, trypsin activity assay kit, 2,2 diphenyl 1 picrylhydrazyl, meta phosphoric acid, amylose, l amino //bid details 2 / 130

Central Government/Public Sector

CTN :42211188 Due date: 20 Oct, 202520 Oct, 2025 NA
Tender For supply of protein expression vectors d d--pet 28c plus dna expression vector, 10ug , pet 32a plus dna expression vector, 10ug , pet 32b plus dna expression vector, 10ug , pet 32c plus dna expression vector, 10ug , pet 22b plus dna expression vector, 10ug , pet 40b plus dna expression vector, 10ug , piex or bac 3 dna expression vector, 10ug , ucoe expression vector mouse 3.2 kb puro set , benzonase nuclease, 10ku , bl21 de3 plyss competent cells, 0.4ml , rosetta gami b de3 plyss competent cells, 0.4ml , novablue competent cells, 0.4ml , x tremegene 360 transfection reagent, 0.4ml , insect genejuice transfection reagent, 0.3ml

Central Government/Public Sector

CTN :42211491 Due date: 30 Oct, 202530 Oct, 2025 NA
Tender For supply of chemical e e -macro tips 5ml , ammonium sulphate for plant tissue culture 500 gm , calcium chloride dihydrate for tissue culture 500 gm , sucrose for tissue culture 5 kg , sodium thiosulphate anhydrous extrapure ar 500 gm , agar tissue culture tested 500 gm , wide mouth bottle ldpe , wide mouth square bottle hdpe , jerrican hdpe , wash bottle new type , analytical long stem funnel pp , accupipet-starter kit , macro tips 5 ml , spinix- vortex shaker , spinwin mc-00 micro centrifuge , nitrile gloves powder free , kimwipes wipes , test tube cap pp , planton , staining box pp , biohazard bags pp , autoclavable bags pp , 5-sulphosalicylic acid dihydrate acs , tris buffer for hplc 99 9 , luria bertani broth , luria bertani agar , n-hexane pure 99 , agarose high eeo for molecular biology , citric acid anhydrous extrapure 99 , sodium bicarbonate extrapure, 99 , silica gel blue self indicating coarse 58 mesh , boric acid extrapure 99 5 , phytic acid sodium salt hydrate insp6 extrapure 70 , polyethylene glycol 6000 powder peg 6000 , isopropanol ipa for molecular biology 99 8 , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof a , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof b , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof c , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof d , longamp taq dna polymerase 500 units , q5 high-fidelity dna polymerase - 100 units , ecori - 10000 units , bamhi - 10000 units , hind- iii-hf - 10000 units , bsai-hf v2 - 1000 units , primescrip 1st strand cdna synthesis kit , e coli dh5 competent cells , e coli dh5 competent cell , mighty cloning reagent set blunt end , mighty cloning reagent set blunt end s , water nuclease free , murashige skoog medium w o sucrose agar , hwso9 , hwg09 , salicyclic acid , indole-3-acetic acid iaa , 6-aminopurine vitamin b4 , gibberellic acid ga3 , jasmonic acid , ethephon , generuler 50 bp dna ladder ready-to-use 50 g , generuler 1 kb dna ladder 5 x 50 g , dntp set 100 mm solutions 4 x 1 ml , dreamtaq dna polymerase 500 u , 6x dna loading dye 5 x 1 ml , water nuclease-free 4 x 1 25 ml , water nuclease free 30 ml , phusion high-fidelity dna polymerase 100 u , 0 510 l universal fit gentip natural, bulk low retention non sterile , 100 1000 l universal fit gentip natural, bulk bevelled low retention non sterile , 0 2ml clear 96 well pcr plate no skirt high profile , sealing mat for 96 pcr plate white , storage rack for 1 5 2 0ml tubes assorted 100 well , autoclave bags 415 x 600mm , centrifuge tube with cap conical, sterile racked , 25 well pc rack , micro tube rack 1 5 ml , digital micro pipette , tips for gensleek-10000 clear , parafilm m sealing film , silicone lab mat , magbox , cube tube rack , adapt-a-rack , floating microtube rack , sample container , carboys with stopcock , 4-layer pp activated carbon lab mask , tough-tags , thermo-labserve soft blue nitrile gloves , thermo-labserve soft blue nitrile glove , kimberly-clark purple nitrile gloves-m , safeskin purple nitrile gloves-l , ethanol molecular biology grade , autoclavable bag , accupipette 1 5ml , moisture proof bottle with inner lid 1 litre , cuvettes disposable 4ml , test tube basket 160 160 160 mm , face mask , porcelain buchner funnel , ceramic heater quartz tube-4l , double distillation unit 2 5 lph with quartz heater , ceramic //bid details 2 / 61 heater_quartz tube 2 5 l accs , circulating water bath 12 ltr , magnetic stirrers heat stir , hot plate , glass dryer
 Loading, Please wait...

Connect us via What's Up