Web Analytics Made Easy - StatCounter

Melamine Tenders

Get complete information related to latest Melamine Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Melamine Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Melamine Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :38604439 Due date: 30 Dec, 202430 Dec, 2024 NA
Tender For specifications of tea poy material: mahacony wood, size: 36 inches x 21 inches, style: basic as per photo attached, colour: teak finish matte, polish: sheenlac polish & melamine matte (sheenlac mate rial only), warranty period: 5 years, service centre: service centre should be available at any of location ov er salem division jurisdiction. supply: mettupalayam, tiruppur, coonoor. 1 sample to be supplied at consig nee office before full supply. detailed specification and photo is attached as annexure. [ warranty period: 60 months after the date of delivery ]

Central Government/Public Sector

CTN :38604444 Due date: 30 Dec, 202430 Dec, 2024 NA
Tender For single seater wooden sofa material: mahacony wood, total number of seats in the sofa set 1, size: 27d x 29w x 36h inch, style: antique, traditional (as per photo attached), frame covering : ful ly upholstered (colour variable), sofa set is foldable to use as bed: no, backrest cushion material: foam, d ensity of cushion of backrest material: 32, density moulded foam covering material for seat and backrest : suede fabric 35mm, frame structure material and size (plus or miuns 1 mm): any other wood of min 1.5 in ch thickness, seat cushion material : polyurethane moulded foam, type of spring in the base / seating : no , colour : teak finish matte, polish : sheenlac polish & melamine matt (sheenlac material only), warranty p eriod : 5 years, service centre : service centre should be available at any of location over salem division jur isdiction, supply: mettupalayam, podanur jn, coimbatore north, coonoor, ooty. 1 sample to be supplied at consignee office before full supply. detailed specification and photo is attached as annexure. [ warranty period: 60 months after the date of delivery ]

Central Government/Public Sector

CTN :38604445 Due date: 30 Dec, 202430 Dec, 2024 NA
Tender For wooden sofa set (3+1+1) material: mahacony wood, total number of seats in the sofa set : 5, number of single seater units (nos):2, number of three seater units (nos):1, size : 27dx 70wx36h inch (three seater), style : antique, traditional, frame covering : fully upholstered (colour variable-final colour will be selected by consignee after issuance of p.o), sofa set is foldable to use as bed :no, backrest cushio n material : foam, density of cushion of backrest material: 32 density moulded foam, covering material for seat and backrest : suede fabric 35mm, frame structure material and size (plus or minus 1 mm): any othe r wood of min 1.5 inch thickness, seat cushion material: polyurethane moulded foam, type of spring in the base / seating: no, colour : teak finish matte, polish: sheenlac polish & melamine matt (sheenlac material only), warranty period : king size mat: 5 years, supply : mettupalayam, podanur jn, coimbatore north, coo noor. 1 sample to be supplied at consignee office before full supply. service centre: service centre should be available at any of location over salem division jurisdiction. detailed specification and photo is attached as annexure. [ warranty period: 60 months after the date of delivery ]

Central Government/Public Sector

CTN :38605222 Due date: 30 Dec, 202430 Dec, 2024 NA
Tender For king size cot (wooden double cot) material : kerala solid teak wood (grade ii), head board & leg board 4 inch x 4 inch solid teak wood (back 18 mm ply) and platform: side bar 5 x 1.5, inner bar- 4 x 1.5, bed side 12mm wood, bottom side 3 x 1.5 (6 nos) inches, size: king size (6 feet x 6.5 feet ), weight of material: 118 kg (plus or minus10 kg), size: 84d x 75w x 44h inch, style: antique traditional (as per photo attached), colour: teak finish matte, storage: without storage, polish: sheenlac polish & melamine semi m atte king size cot (sheenlac material only), warranty: 10 years, service centre: service centre should be a vailable at any of location over salem division jurisdiction. supply: mettupalayam, tiruppur, podanur jn. 1 s ample to be supplied at consignee office before full supply. detailed specification and photo is attached as annexure. [ warranty period: 120 months after the date of delivery ]

CTN :38556023 Due date: 03 Jan, 202503 Jan, 2025 NA
Tender For supply of modular type kitchen shelf made of rubber wood with melamine pu polishing size 8 x 4 x 2 ft , modular type display unit cupboard made of rubber wood with melamine pu polishing size 6 x 2.5 x 2 ft , modular type office table made of rubber wood frame with melamine pu polishing size 5 x 2 ft , modular type visitor side table made of rubber wood with melamine pu polishing size 4 x 2.5 x 2 ft , modular type wooden storage specialty for storage of ration , modular type wooden entrance with glass made of rubber wood with melamine pu polishing size 7 x 3 ft , wooden first sid box with wooden beadings , modernised kitchen washing point for industrail scale utensils

Central Government/Public Sector

CTN :38600845 Due date: 09 Jan, 202509 Jan, 2025 NA
Tender For supply of alt-r crispr-cas9 crrna (sbe1 g1: taatactccaaacaccaaac) , alt-r crispr-cas9 crrna (sbe1 g2: tcaaacatggtaatggagtg) , alt-r crispr-cas9 crrna (sbe1 g3: gattcgtggggctcggggtt) , alt-r crispr-cas9 crrna (sbe1 g4: cttgggtttacaggttctgg) , alt-r crispr-cas9 crrna (sbe2 g1: gagaggggcatccctccacc) , alt-r crispr-cas9 crrna (sbe2 g2: tacaggaagtgttgaagagc) , alt-r crispr-cas9 crrna (sbe2 g3: ggaaatcaatccactcaggg) , alt-r crispr-cas9 crrna (bam9 g1: gttgggactactcaagggca) , alt-r crispr-cas9 crrna (bam9 g3: cttgagtagtcccaacacgg) , alt-r crispr-cas9 crrna (bam3 g1: ggaaaggatgactggggcca) , alt-r crispr-cas9 crrna (bam3 g2: aaggggtgatggtggatgct) , alt-r crispr-cas9 crrna (bam3 g3: gctttcctgaataccactct) , alt-r crispr-cas9 crrna (pram g1: cagcaaccgatttgatcccg) , alt-r crispr-cas9 crrna (pram g2: gttccagacttggctaaagc) , alt-r crispr-cas9 crrna (pram g3: cacaatattctgatggcacg) , alt-r crispr-cas9 crrna (st23 g1: tggcacggggaatctagaca) , alt-r crispr-cas9 crrna (st23 g2: cgggaaaccggactataacc) , alt-r crispr-cas9 crrna (a48 g1: gaaggaacgacctccagaaa , alt-r crispr-cas9 crrna (a48 g2: taaccgtcgctgggatctat) , alt-r crispr- cas9 crrna (a75 g2: atcacaatcaagatccgcat) , alt-r crispr-cas9 crrna (sp g1: gcacggttcgagaagagatc) , alt-r crispr-cas9 crrna (sp g2: tgaactgcttcctcggcacg) , alt-r crispr-cas9 crrna (sp g3: ggcagaaactacgaacgaag) , alt-r crispr-cas9 crrna xt , alt-r crispr-cas9 tracr rna , alt-r s. p. hifi-cas9 nuclease v3 , nuclease free duplex buffer (10 2 ml) , idte (1x te solution; 10 2 ml) bid number/ ( ( ) ) : gem/2024/b/5712833 dated/ * : 16-12-2024 bid document/ 2 2 1 / 20

CTN :38589437 Due date: 04 Jan, 202504 Jan, 2025 NA
Tender For supply of orthopedic classic memory foam mattress size 72 x 60 x 6 inch,door curtains fabric cloth size 2.13 x 1.22 mtr,window curtains fabric cloth size 1.5 x 1.22 mtr,led smart tv 32 inch,fridge single door 192 ltrs capacity,stainless steel drying stand,foot mat size 3 x 2 ft,pillow with hollow microfiber size 685 x 455 cm,bedsheet with pillow cover size 198 x 152 cm,comforter size 2.54 x 2.29 mtr,washing machine 8 kg semi automatic,induction stove 2000 watt,electric kettle 1.5 ltr capacity,water camper 10 ltrs capacity,cup with saucer ceramic,water glasses,dinner plate melamine,stainless steel spoons,bathroom wiper,wall clock,bucket 20 ltr with mug,hanger,dustbin pedal type,water cooler with ro plant,door mat size 3 x 2 feet,carpet size 6 x 4 ft

Central Government And Public Sector

CTN :38556367 Due date: 02 Jan, 202502 Jan, 2025 1.50 Lacs
Tender For supply of 50x tae buffer tris acetate edta electrophoresisbuffer , 3 8 diamino s ethyl 6 phenyl phenanthridinum bromide solution , dna blood mini kit 50 , agarosepowderforelectrophoresis500gm , tube5xseqbuffersmalleach , 100bpdnaladder50ug , cryotags13x19mm

Central Government And Public Sector

CTN :38556433 Due date: 03 Jan, 202503 Jan, 2025 NA
Tender For supply of pbs ph 7 4 500ml , tmb solution ready to use , carbonate bicarbonate buffer for elisa ph 9 6 , 0 5 10ul microtips with filter with rack box 960 tips by case , sodium chloride 500gm , spectra por 131090t biotech grade dialysis tubing trial kit 0 5 1 0 kdalton 16 mm , borosilicate glass petridishes 90mm x 17mm 10 pieces per pack , tmb substrate solution make himedia

CTN :38533345 Due date: 31 Dec, 202431 Dec, 2024 7.97 Lacs
Tender For supply of executive table,side unit,single seater chair,console,executive revolving chair,medium back chair,single seater sofa,two seater sofa,center table,corner table,discussion table,console of size 1500,console of size 750,linear workstation,75 mm thick partation,coat stand,wallpapers,led display panel,melamine polishing,upholstery
 Loading, Please wait...

Connect us via What's Up