Latest michelson interferometer Tenders | Government michelson interferometer Tenders

Central Government/Public Sector

CTN :42306399

05 Nov, 2025 21.34 Lacs

Bhimtal - Uttarakhand

Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

Central Government/Public Sector

CTN :41955779

20 Oct, 2025 NA

Kozhikode - Kerala

Tender For corrigendum : supply of neb chemicals and consumables d d--hpaii , mspi , bsai hf r v2 1000 units , t4 polynucleotide kinase 500 units , t4 dna ligase 20000 units , monarchr spin plasmid miniprep kit 50 preps , monarchr genomic dna purification kit 50 preps , monarchr spin rna isolation kit 50 preps , m0667t engenr spy cas9 hf1 500 pmol , e3322s engenr sgrna synthesis kit s pyogenes 20 reactions , t2040s monarchr spin rna cleanup kit 10 preps , m0689s neb authenticaser 25 reactions , e3321s engenr mutation detection kit 25 reactions , e2040s hiscriber t7 high yield rna synthesis kit 50 reactions , make neb monarchr spin rna cleanup kit 10 preps , t7 endonuclease i 250 units , engenr sgrna synthesis kit s pyogenes 10 reactions , engenr mutation detection kit 25 reactions , bsai hfr v2 1000 units

Central Government/Public Sector

CTN :42263825

04 Nov, 2025 NA

Delhi - Delhi

Tender For supply of deparaffinization solution d d - deparaffinization solution , sdfcl xylene , adapter dvi to hdmi , adapter hdmi to hdmi , cdna synthesis kit 100 reaction , dna isolation kit

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337

31 Oct, 2025 6.22 Lacs

Hazaribag - Jharkhand

Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

CTN :42154085

30 Oct, 2025 NA

Jhabua - Madhya Pradesh

Tender For lab equipments - lab equipments, imported binocular microscopes, portable water/soil kit, digital bod incubator, digital microscope with lcd screen and built in camera microscope , built in camera microscope, digital haemoglobinometer (hbmeter), imported trinocular microscopes, autoclave, deep freezers 100 liter, imported trinocular microscopes, water analyzer with colorimeter, d.o. meter, condu-ctivity, tds, ph, salinity and temperature, autoclave, activity tds ph and temperature (water analyzer with colorimeter, d.o. meter, condu-ctivity, tds, ph, salinity and temperature ), digital thermal cycler pcr, dissolved oxygen meter, cod analyzer with digestor, flame photometer, semi automatic microtome, interactive uhd led board, distilling apparatus condenser, semi automatic finecare immunoassay analyzer, electronic micro balance, viscocitymeter bath, digital flame photometer with solution and compressor, digital potentiometer, ultrasonic interferometer, uv visible spectrophotometer, phase contrast microscope, hot air oven universal msw 211, water bath rectangular single walled msw-271, heating mantle msw-431, bunson burnars, burret stand, hot plate magnetic stirrer, double stage vacuum pump, digital flame photometer dual channel, columns for columns chromatography, polarimeter, digital abbe refractometer, ft-ir spectrometer this instrument is operated by a pc with user friendly software and a comprehernsive mannual, mixer / grinder, blotting paper, ganongs potometer, farmer s potometer, ganong light screen, ganongs respirometer, wilmots bubler appratus, arthron reagent, micropipet, acetone gas jar, farmerse photometer, stage micrometor, gas cylinder, 5 liter copper ghada, freeze /doubal door( 230 lit.), bm slide cabinate(capacity2000 slides size 15x18x3, cooling centrifuge (thermo scientific), scepter cell counter (merck millipore), spectrophotometer, microtome rotary, bactrial colony count, tlc apparatus, osmotic pressure apparatus, seed germinattormsw 124, humidity & temperature control cabinetmsw125, plant growth msw130, tissue culture rack msw-168, function generator, dual trace cro, study of elastic constant, susceptibility measurements, study o frank and hertz experiment, study of calcite prism, four probe methods, fourier analysis, oscilltors - wein bridge/hartley, study of ac oustical and optical modes, di electric constant, pn junction diode, e/m by thomsons method, study of solar cell, e/m by zeeman effect, hall effect, newtons ring app, rydbergs constant, gm counter, michelson interferometer, febry parot interferometer, rocks, minerals and fossils showcase almirah with glass, satellite imagery, gps wireless pocket receiver for survey or geologist (s750 model), projector, fossils, fossils, micro scope ( petrological polarized microscope), 3d models ( structural geology), geological brunton compass with black lather case compass (black), digital camera, thin section of rocks slide, thin section of rocks slide, resistivity meter, slide film projector, india/asia/mp /world map physical and political, (tracing table with stand), (plumb bomb), prismatic compass, tripod stand, tape 50m, plain table tripod stand steel,sampatal wood set, simple aluminum alloy and fork, trough compas, engineering chain 100 feet, classical globe, theodo light complete set (tripath stand steel, reading scale, solar system automatic, french curve, natural map of the world in hindi 3d with frame, world political map in hindi 3d with frame, physical map of india in hindi 3d with frame, political map of india hindi 3d with frame, natural map of madhya pradesh in hindi 3d with frame, political map of madhya pradesh in hindi 3d with frame, inverter + battery, water cooler with ro, sanitary vending machine

Central Government/Public Sector

CTN :42164414

27 Oct, 2025 NA

Surat - Gujarat

Tender For providing of custom bid for services - michelson interferometer kit

Central Government/Public Sector

CTN :42096479

21 Oct, 2025 NA

Delhi - Delhi

Tender For supply of cryo embedding tissue compound 120ml , sdfcl xylene 1 litre , aniline blue , ffpe dna isolation kit , ffpe rna isolation kit , cdna synthesis kit

Michelson Interferometer Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector