Get complete information related to latest Microbial Culture Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Microbial Culture Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Microbial Culture Tenders.
Tender For corrigendum : supply of enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) , thinner for cellulose nitrate based paints and lacquers (q3) , ready mixed paint, air drying, red oxide zinc chrome, priming (v2) as per is 2074 (q3)
Tender For supply of isosorbide dinitrate 10 mg tab , itraconazole 100 mg cap , ketamine hcl 50 mg per ml 2 ml inj , ketoconazole 2 percent plus zinc pyrithione 1 percent bottle of 60 ml , labetalol hcl 5mg per ml 4ml inj , levetiracetam 100 mg per ml vial of 5 ml inj , levosalbutamol sulphate 2 point 5 ml containing 1point 25 mg respule , lignocaine hcl 2 percent without adrenaline 30 ml inj , linezolid 600 mg tab , lorazepam 1 mg tab , lorazepam 2mg per ml 2 ml inj , medicated band aid , mephentermine sulphate 30 mg per ml inj , metformin sr 0 point 5gm tab , metoclopramide 10 mg tab , metoprolol 1 mg per ml 5 ml inj , metronidazole 400 mg tab , metronidazole susp 200 mg per 5ml bott of 60 ml , miconazole nitrate cream tube of 30 gm , minoxidil 5 percent lotion bott of 60 ml , mometasone 0 point 1 percent tube of 10 gm , montelukast 10 mg plus levocetrizine 5 mg tab , morphine 15 mg 1 ml inj , moxifloxacin 0 point 5 percent eye drop , multivitamin syp bott of 200 ml , mupirocin 2 percent oint tube of 5 gm , neostigmine 0 point 5 mg 1 ml inj , nifedipine retard 20 mg cap oblique tab , nitrofurantoin 100 mg tab , octreotide 0 point 1mg per ml inj , ointment betamethasone dipropionate 0 point 05 percent and salicylic acid 3 percent tube of 20 grams , ondansetron 2mg per ml 4 ml inj , ondansetron 8 mg tab , ondansetron syp 2 mg per 5ml in bott of 30 ml , ornidazole 500 mg plus ofloxacin 200 mg tab , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape 30 cm , pancuronium bromide 2 mg per ml 2 ml inj , pantoprazole plus domperidone tab , paracetamol 150mg per ml 2 ml iv inj , paracetamol 325 mg plus ibuprofen 400 mg tab , paracetamol 650 mg tab , paracetamol syp125 mg per 5 ml bottle of 60 ml , paracetamol with cysteine hcl monohydrate infusion 1000mg per 100ml , paradichlorobenzene benzocaine chlorbutol and turpentine oil ear drops , pencil cell aa , pencil cell aaa , pethedine 50 mg 1 ml inj , phenytoin sodium 50 mg per ml inj , polidocanal inj , potassium chloride 15 percent inj iv amp of 10 ml 1 point 5 gm , povidone iodine oint tube of 20 gm , prednisolone 40 mg tab , primaquine 7 point 5 mg tab , propranolol tr 40 mg tab , purified chick embryo cell vaccine , purified vero cell rabies vaccine , rabeprazole 20 mg plus domperidone 10 mg tab , rabeprazole 20 mg tab , ranitidine 150 mg tab , serratiopeptidase 5 mg tab , sodium bicarbonate 7 point 5 point amp of 10 ml , soft cervical collar , spinal needle 25 g , spinal needle 26 g , suspensory scrotal , syrup codeine phosphate 10 mg plus chlorphenaramine maleate 4 mg per 5 ml bottle of 100 ml , syrup terbutaline sulphate 1 point 25 mg plus bromhexine hcl 4 mg plus guaiphenesin 50 mg per 5 ml bottle of 100 ml , terbinafine 1percent cream tube of 10 gm , thiopentone inj 0 point 5 gm without water for inj , tinidazole 500 mg tab , tramadol hcl 50mg per ml inj 1 ml amp , tranexamic acid 500 mg tab , tranexamic acid 500 mg per 5ml inj , terlipressin injection 1 mg per 10 ml inj , triamcinolone acetate 10 mg per ml inj , troponin t test card , typhoid vi polysaccharide 0 point 5ml vial oblique pfs , urea cream urea 10 to 12 percent lactic acid 5 to 10 percent in pack of 50 gm , vit d 3 60000 iu per 1gm sachet cholecalciferol , vitamin b complex with a minimum concentration of vit b1 5mg vit b6 3mg and vit b12 5mcg therapeutic tab oblique cap , vitamin b1 b6 and b12 inj neurobion , vitamin e 200 mg cap , vitamin e 400 mg cap , chilblains cream bid details/ 2 / 64
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76