Ms Cot Tenders

Get complete information related to latest Ms Cot Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ms Cot Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ms Cot Tenders .

Filter

Loading....

Get Tender in Email

Central Government And Public Sector

CTN :39772888

14 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For supply of laboratory benches for dry lab , laboratory island table for dry lab , laboratory benches for wet lab , laboratory island table for wet lab , laboratory fume hood , laboratory lab stools , laboratory overhead unit (size 750 (w) mm x 320 (d) mm, 675 (h) mm) , ss dining table with fixed stool 8 seater (size 2400 (w) mm, 850 (d) mm, 800 (h) mm) , ss dining table with fixed stool 4 seater (size 1200 (w) mm, 850 (d) mm, 800 (h) mm) , modular workstations (size 750 (w) mm, 600 (d) mm, 1200 (h) mm) , workstation chairs

Central Government/Public Sector

CTN :38813549

22 Mar, 2025 NA

Gwalior - Madhya Pradesh

Tender For bid to ras tender for supply of modified oligonucleotides primer and probes - ft tul4 gc 1 f aacaacccaagaaatccaacaaa 200nm hplc-dry , ft-tul4-gc-1-r-agaggctttagcaagctctga-200nm-hplc-dry , ft tul4 gc 2 f acaaagtgttgataaaacaacccaa 200nm hplc-dry , ft-tul4-gc-2-r-tcaatgctgtccatgtccca-200nm- hplc-dry , ft-fpoa-gc-1-f-cttatgtttcggcatgtgaatagt-200nm-hplc-dry , ft-fpoa-gc-1-r-tctttaagtggagctgatacgc-200nm-hplc-dry , ft-fpoa-gc-2-f- tcttatgtttcggcatgtgaatag-200nm-hplc-dry , ft-fpoa-gc-2-r- cttctttaagtggagctgatacgc-200nm-hplc-dry , ft-igle-gc-1-f-aggatggcaaaaacaaggagaag-200nm-hplc-dry , ft-igle-gc-1-r-tgaaaatatggtctgcttttgaca-200nm-hplc-dry , ft-igle-gc-2-f-ggcaaaaacaaggagaagtcaatg-200nm-hplc-dry , ft-igle-gc-2-r-tgaaaatatggtctgcttttgacat-200nm-hplc-dry , ft-tolc-gc-1-f-agttaacattatatcttttaggttttttgggg-200nm-hplc-dry , ft-tolc-gc-1-r-ttactccgttgcaatctgcgatatt-200nm-hplc-dry , ft-tolc-gc-1-f-cattatatcttttaggttttttggggttt-200nm-hplc-dry , ft-tolc-gc-1-r-gcaatctgcgatattatatctgtagt-200nm-hplc-dry , bg-atpd-1-f-gctagaggtcgcacttcattta-200nm-hplc-dry , bg-atpd-1-r-taccaaccggcactgaaatag-200nm-hplc-dry , bg-atpd-2-f-cacttcatttaggcgacgatact-200nm-hplc-dry , bg-atpd-2-r-ttgtctgtgaatcggatctttctc-200nm-hplc-dry , bg-rec-a-1-f-gctttccggagcaatcaataag-200nm-hplc-dry , bg-rec-a-1-r-cacttctaaccgtacagaggaataa-200nm-hplc-dry , bg-rec-a-2-f-gctgaaattgaaggagacatgg-200nm-hplc-dry , bg-rec-a-2-r-gacttattgattgctccggaaag-200nm-hplc-dry , bg-sod-sol-sym-f-acagtggagattagccaagaaacac-200nm-hplc-dry , bg-sod-sol-sym-r-gtacatacagcgaaccctgaatttc-200nm-hplc-dry , bg-its region-f-cattcgattcttcgagatg-200nm-hplc-dry , bg-its region-r-ggtcttacttttgaatgtgatgtc-200nm-hplc-dry , ms2 rnarep 1 f cggctcaaatccgttggtatag 200nm hplc dry , ms2 rnarep 1 r ggaatcggatgcagacgataag 200nm hplc dry , ms2 rnarep 2 f gctctgagagcggctctattg 200nm hplc dry , ms2 rnarep 2 r cgttatagcggaccgcgt 200nm hplc dry , ms2 lysis prot 1 f cagcaatcgcagcaaactc 200nm hplc-dry , ms2-lysis prot-1-r-gagagaaagatcgcgaggaag-200nm-hplc-dry , ms2-lysis prot-2-f-cctcagcaatcgcagcaaa-200nm-hplc-dry , ms2-lysis prot-2-r-ggaagatcaatacataaagagttgaacttc-200nm-hplc-dry , ms2-hmp-1-f-aacgggtgagtccatcataag-200nm-hplc-dry , ms2-hmp-1-r-cgatgcatggctgagatttg-200nm-hplc-dry , ms2-hmp-2-f-ccagacaacgtgcaacatatc-200nm-hplc-dry , ms2-hmp-2-r-ccacactatacctagtgggttc-200nm-hplc-dry , ms2-cotp-1-f-ctgcgcagaatcgcaaatac-200nm-hplc-dry , ms2-cotp-1-r-gaagctctacaccaccaaca-200nm-hplc-dry , ms2-cotp-2-f-cgttcacaggcttacaaagtaacct-200nm-hplc-dry , ms2-cotp-2-r-ccaacagtctgggttgccac-200nm-hplc-dry , pa-auto-synth-1-f-ccatgagaaagtgtgggaaatg-200nm-hplc-dry , pa-auto-synth-1-r-gttgccgaactgatgatgtattc-200nm-hplc-dry , pa-auto-synth-2-f-gctaccgatacagcgtcttt-200nm-hplc-dry , pa-auto-synth-2-r-cgtagcgatcatattcctgtcc-200nm-hplc-dry , pa-chor-mut-1-f-ctcttggatcactctcttctgc-200nm-hplc-dry , pa-chor-mut-1-r-gaggcagatcctcaataggtaaat-200nm-hplc-dry , pa-chor-mut-2-f-cgtttgtgcacgctttgat-200nm-hplc-dry , pa-chor-mut-2-r-gttgtatctgctgtctggtctc-200nm-hplc-dry , pa-dna-heli-rep-1-f-gcgatcgcagcaggataata-200nm-hplc-dry , pa-dna-heli-rep-1-r-ttcacgcacctcctgattac-200nm-hplc-dry , pa-dna-heli-rep-2-f-ccggacgcagtacaaagatta-200nm-hplc-dry , pa-dna-heli-rep-2-r-ccagagatgcgataagggatg-200nm-hplc-dry , pa-scar-mar-f-atgagccctgtgatcaggaagatcg-200nm-hplc-dry , pa-scar-mar-r-acgatgagccttctcagcaaatgcg-200nm-hplc-dry , genomic region f 261 r 369 f-ggttcgtcaaggactggttt 200nm hplc-dry , genomic region f-261 r-369-r-ttgaacagcatcggactcag-200nm-hplc-dry , genomic region f- 119 r-369-f-actgctggcggaaaatgaga-200nm-hplc-dry , genomic region f- 119 r-369-r-ttgaacagcatcggactcag-200nm-hplc-dry , x174 m spi prot 1 f-gtttggttcgctttgagtcttc 200nm hplc-dry , x174m spi prot 1 r cacacagtccttgacggtataa 200nm hplc dry , x174-m-spi-prot-2-f-cccgactgcctatgatgtttat-200nm-hplc-dry , x174-m-spi-prot-2-r-gtcaatagtcacacagtccttga-200nm-hplc-dry , x174-terminase-1-f-cgacctttcgccatcaacta-200nm-hplc-dry , x174-terminase-1-r-cgaacgtgccaagcatattaag-200nm-hplc-dry , x174-terminase-2-f-ctttcgccatcaactaacgattc-200nm-h

Central Government/Public Sector

CTN :39753233

09 Apr, 2025 NA

Jodhpur - Rajasthan

Tender For supply of laboratory furniture - modular laboratory furniture units , laboratory modular furniture , laboratory benches wall type , chemical storage cabinet , modular laboratory furniture laboratroy , table with granite top and drawers , sample preparation table , laboratory island half table with storage rack , lab bench type -1 , lab bench type-2 , laboratory island half table without storage rack , laboratory chairs with wheels and backrest , laboratory benches wall type-1 , laboratory benches wall type-2 , laboratory benches wall type with wash basin , laboratory island type table , chemical cabinet almirah , hydraulic steel stool , lab table with granite top and cupboard , rolling step stool , granite top table , laboratory benches wall table , equipment accessories table , lab chairs , wooden table -t1 , wooden table -t2 , wooden chair , wooden almirah , particle board ladder with handrail , laboratory benches wall type -1 , wooden table type-1 , wooden table type-2 , lab chairs with backrest and wheels , lab benches island lab benches with two tier reagent rack , wall side laboratory bench with reagent rack , island laboratory bench without reagent rack

Central Government/Public Sector

CTN :39724424

31 Mar, 2025 13.10 Lacs

Hyderabad - Telangana

Tender For supplying and installation of tables for instruments, steel modular racks and doors for geological samples storage and replacement of loft shutters in the chemistry laboratory