Latest nevirapine tab Tenders | Government nevirapine tab Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39809833

14 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of clindamycin 300 mg cap , cefixime 200 mg tab , emtricitabine 200 mg plus tenofovir 300 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300 mg plus lamivudine 150 mg plus nevirapine 200 mg tab , polyethylene glycol 400 nf 0 point 4 percent propylene glycol 0 point 3 sorbitol hp gaur borate polyquad 0 point 001 percent 10 ml bottle , pristine ns prime large 20 cm x 20 cm wipes imprengnated with normalsaline solution individually packed and gamma sterilized box of 20 wipes , cyclosporine emulsion 0 point 05 percent with glycerine caster oil polysorbate 80 carbomer 1342 preservative free aa pack of 30 vial of 0 point 4 ml each , nepafenac mocronised suspension 0 point 1 percent with bak free iit technology in packing of 5 ml , antacid chewable containing dried aluminium hydroxide ip 250 mg mag hydroxide nf 250 mg methyl polysiloxane , syp zinc 20 mg per 5 ml bottle of 100 ml , syp levosalbutamol 1 mg per 5 ml bott of 100 ml , dexamethasone 4 mg , tab methotrexate 15 mg , hepatitis b vaccine 10 ml , injectable typhoid vaccine 2 point 50 ml

State Government

CTN :39391119

01 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, acyclovir 3%(ointment),ointment, alfacalcidol 0.25mcg, calcium 200mg (0.25mcg+200mg),capsule, alfuzosin (10mg),tablet /capsule, amantadine (100mg),tablet, amisulpride (50 mg),tablet, anti d immunoglobulin for iv/im use (monoclonal) (150mcg (1ml vial)),injection, anti thymocyte globulin (250mg/5ml),injection, atorvastatin + asprin (10mg + 75mg),tablet or capsule, bisoprolol (5 mg),tablet, busulphan(60mg/10ml),injection, canagliflozin (100 mg),tablet, carbamazepine(100 mg / 5ml 100ml bottle),syrup, chlorthalidone (12.5mg ),tablet, clobetasole propionet 0.05% + salicylic acid 3% (15gm tube),ointment, cyclosporine (100mg),capsule, cyclosporine(100mg/ ml),solution, cyclosporine(50mg),capsule, dacarbazine 200mg (10mg/ml),injection, diclofenac+paracetamol+chlorzoxazone (50mg + 325mg + 250mg),tablet, diloxanide furoate (tablet 500 mg),tablet, etophylline + theophylline sr tablet 231mg + 69mg,tablet, fat emulsion 20% (250ml),injection, ferric carboxymaltose 50mg/ml(20ml vial),injection, fluvoxamine (100mg),tablet, fluvoxamine (50mg),tablet, formoterol 6mcg + budesonide 400mcg (30 cap x 6 pack with 1 dispensing device),rotacaps, gatifloxacin (0.3% ),eye drop, glargine 100 iu /ml, 3ml cartridge inj. (firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost)(100 iu /ml),cartridges, glimepride 2mg + metformin 1000mg (tab),tablet, hepatitis b immunoglobulin (100 iu/vial),vial, human insulin regular/soluble (100iu/ml (10ml vial)),injection, hydrocortisone sodium succinate inj. 200mg vial,injection, hydroquinone 2% + mometasone 0.1% + tretinoin0.025% (5 gm tube),cream, hydroxy propyl methyl cellulose injection 2% (3ml prefilled syringe),syrings, ipratropium bromide inhaler 20mcg per puff (200 metered dose container),inhaler, irinotecan hydrochloride (100mg),injection, labetalol 5mg/ml (4ml ampl),injection, lactulose (10gm/15ml (100 ml bottle)),solution, lamotrigine dt tab (100mg),tablet, levetiracetam 100mg/ml syrup/ solution (100ml bottle),syrup, lorazepam (2 mg),tablet, magnesium sulphate injection (50 % w/v 10ml amp),injection, medroxyprogesterone acetate (injection 150 mg 1ml/vial),injection, moxifloxacin ( 400mg),tablet, nepafenac(1mg/ml),eye drop, nicotine (nrt) (2 mg chewing gum ),gum, nicotine (nrt) (4 mg chewing gum ),gum, pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg(tab)(tablet (with additional content acceptable)),tablet, phenobarbitone (200 mg/ml),injection, potassium chloride 150mg/ml injection, 10ml ampoule (10ml ampoule),injection, pregabalin (75mg),capsule, rabeprazole + levosulpiride (20mg +75mg),tablet or capsule, rifaximin (400mg),tablet, sitagliptin (100mg),tablet, sitagliptin + metformin (50mg + 500mg),tablet, sodium hyaluronate (intraocular) (1% /ml),injection, sorafenib (200mg),tablet, tenecteplase (40mg),injection, tenecteplase 20mg (20mg),injection, teneligliptin (20mg),tablet, thyroxine sodium (75 mcg),tablet, tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg (pack of 180 to 200mdi),inhaler, tiotropium 9mcg 180 doses inhaler (180 or more doses acceptable),inhaler, tricholine citrate + sorbitol (550mg + 7.15 g/10ml ),syrup, vinblastine (10mg),injection, vitamin d3 (800iu/ml),drop, voglibose (0.2 mg),tablet, water for injection 5ml amp

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

CTN :39594298

27 Mar, 2025 NA

Kota - Rajasthan

Tender For tender for supply of injection recombinant human erythropoietin alfa 4000iu , tablet rifaximine 400mg , tablet rifaximine 550 mg , tablet risperidone 2 mg , tablet rivaroxaban 10 mg , tablet rivaroxaban 15mg , tablet rivaroxaban 2.5 mg , tablet rizatriptan 10 mg , tablet ropinirole 0.5 mg , tablet rosuvastatin 10 mg , tablet rosuvastin 10 mg aspirin 75mg clopidogrel 75 mg , rotacap salmeterol 50 mcg plus fluticasone 250 mcg , rotahaler , tablet s adenosyl l methionine 400 mg , probiotic fructo oligosaccharide bifido bacterium streptococcus lactobacillus , tablet sacubitril 24mg plus valsartan 26mg , tablet saroglitazar 4 mg , scrotal suspensory , tablet serratiopeptidase 5 mg , tablet sertraline 50 mg , tablet sevelamer foseal 400 mg , ointment silver nitrate plus chlorhexidine , tablet sitagliptin 50 mg , tablet sitagliptin 50 mg tab plus metformin 1000 mg , tablet sodium bicarbonate 500mg , sodium lactate ringer lactate fluid , tablet sodium valproate 200 mg , tablet sodium valproate 300 mg , tablet sodium valproate 500 mg , tablet spironolactone 50 mg , bottle sucralfate 1gm per 5ml of 200 ml , tablet sulfasalazine 500 mg , tablet sumatriptan 50 mg , syrup cetrizine 5mg per 5ml bott of 60ml , syrup chlorpheniramine 1 mg pcm 125mg phenylephrine 2.5mg , syrup cough expectorant 100 ml , syrup domperidone 1 mg per ml bottle of 30 ml , syrup liver tonic , syrup periactin cyproheptadine , syrup tricholine citrate plus sorbitol , ointment tacrolimus 0.3 percent , tablet tadalafil 10mg , tablet tamsulosin 0.4 mg , tablet telmisartan 20mg , tablet teneligliptin 20mg , tablet tenofovir 300 mg , tablet terbinafine 250mg , tablet thiocolchicoside 4 mg , tablet thyroxine 100 mcg , tablet thyroxine 25 mcg , tablet thyroxine 50 mcg , tablet thyroxine 75 mcg , bottle timolol maleate eye drop 0.5 percent of 5 ml , tiotropium bromide 9 mcg 120 metered doses per unit inhale rotacap , tablet tofacitinib 5 mg , tablet tolperisone sr 150 mg , tablet tolterodine 1 mg , tablet tolvaptan 15 mg , tablet topiramate 25 mg , tablet torsemide 10 mg plus spironolactone 50 mg , tablet torsemide 10 mg , capsule tramadol 50 mg , tablet tranexamic acid 500 mg plus mefenamic 250 mg , tablet tranexamic acid 500 mg , tablet trihexyphenidyl 2mg , tablet trimetazidine mr 35 mg , tablet trypsin chymotrypsin 6 ratio 1 100000 au enteric coated , tablet ubidecarenone 300mg , urea cream 50 gm , tablet ursodeoxycholic acid 300mg , tablet vildagliptin 50mg , tablet vit a d comma e comma c comma b1 b12 folic acid biotin , tablet vitamin b complex with vit b1 5 mg vit b6 3 mg vit b12 5 mcg , tablet voglibose 0.2mg , tablet voglibose 0.3mg , nasal drop xylometazoline 10 ml , tablet zolpidem 5 mg , albumin test kit 5 x 50 ml , auto analyser wash solution 4 x 50 ml , bilirubin test kit 4 x 60 ml , blood grouping sera antigen 1 x 10 ml each , brush for test tube wash , calcium test kit 2 x 50 ml , cholesterol test kit 5 x 20 ml , c reactive protien test kit 1 x 25 test , creatinine test kit 4 x 60 ml , dengue igg igm test rapid , dengue ns1 test rapid , glucose test kit 2 x 200 ml , hbsag card , hdl cholesterol test kit 2 x 50 ml , malaria parasite paracheck test card , micropipette tips for 10 dash 100ul , micropipette tips for 1000ul , printer paper for erba , protein test kit 5 x 50 ml , prothrombin time test kit 2 x 5 ml , ra factor test kit 1 x 25 test , sgot test kit 5 x 20 ml , sgpt test kit 5 x 20 ml , slide for microscope , triglyceride test kit 5 x 20 ml , urea test kit 5 x 20 ml , uric acid test kit 5 x 20 ml , sterile urine container plastic , uristixs test for albumin sugar bott of 100 , widal test kit 2 x 2 x 5 ml , hypochlorite solution 10 percent , westergren esr tube pkt of 100 tubes

CTN :39481966

05 Apr, 2025 NA

Dehradun - Uttarakhand

Tender For corrigendum : supply of veterinary allopathic medicines - albendazole bolus (1500 mg), albendazole bolus (3000 mg), albendazole susp. (2.5%w/v), albendazole susp. (5% w/v), albendazole + clorsulon bolus (1.25 g + 70 mg), albendazole + ivermectin bolus (1500 mg+ 100 mg), amitraz susp. (12.5% w/v), amprolium hcl + vitamin k3 (20% w/w+2mg as sodium salt), antimony pot. tartrate +ferrous sulpate +cu so4.+co cl.bolus (2gm+2gm+50mg+100mg/ bolus), atropine sulphate ip (1mg/ml ), bolus ciprofloxacin + tinidazole (1500 mg +1800 mg /bolus), benzoic acid ip 5% w/w + boric acid ip 4.5% w/w + salicyclic acid ip 3.5% w/w+ zinc oxide ip 4.5% w/w + sulphur ip 1% w/w, calcium borogluconate+ magnesium phosphate+ dextrose anhydrous (1.86% + 5% + 20%), cefuroxime sodium (250 mg/ 3.5 g syringe), cephalexin + neomycine sulph. + prednisolone (100 mg+100 mg+ 10 mg), cephalexin powder (7.5 % w/w), chloramphenicol eye ear drops (5%), chlorhexadine gulconate+cetrimide sol. (7.5%+15%w/v), cholistine sulphate powder (100 gm), ciprofloxacin + tinidazole i/u susp.(each 5 ml contains 125 mg+150 mg), clomiphene tab & copper sulphate fertility kit(500 mg clomiphene 1tab + 750 mg copper sulphate 2 tab), clorsulon + ivermectin + exipi. qs susp.(10 mg+ 10 mg /ml), closantel bolus (1gm), colistin sulphate+cloxacillin sodium (500000 iu + 200 mg), cyperheptadine hcl + cocl + vit.b1, b6, b12 (25 mg + 100 mg + 50 mg + 50 mg + 500 mg), cypermethrin high cis(12% w/v), cypremethrine high cis+ ethion solvent (12% w/v, 8% w/v qs), deltamethrin solution (1.25% w/v), dried aluminium hydroxide+ magnesium hydroxide + activated dimethicone (600 mg + 250 mg + 50 mg / 5 ml), dried aluminium hydroxide+ simethicone + sorbitol solution (70%)+ dill oil+ suspension base (600mg+300mg+400mg+100mg+50mg), enrofloxacin susp. (10%), fenbendazole + ivermectin bolus (3 g + 100 mg), fenbendazole + oxyclozanide bolus (1gm+ 800 mg), fenbendazole + rafoxanide bolus (2gm+3gm), fenbendazole bolus (1500 mg), fenbendazole bolus (3000 mg), fenbendazole susp. (10%), flumethrin solution (1%), furazolidone + metranidazole (500 mg+ 1000 mg / bolus), gamma benzene hexachloride + cetrimide+ proflavin hemisulphate+ eucalyptus oil + turpentine oil as base, gentamicin+clotrimazole+ betamethasone (0.3% w/w+1.0% w/w +0.02% w/w) eye/ ear drops, gluteraldehyde + didecyl dimethyl ammonium chloride + benzalkonium chloride ( 11.00 g + 8.18 g + 17.85 g) / 100 ml isopropyl alcohol & pine oil as excipient, hypochlorous acid (135 mg/l), inj ceftiofur sodium, inj ranitidine (50 mg/2ml) usp, inj. prednisolone acetate ip 10mg/ml, inj. ringer lactate, inj. tylosin (20%), inj. analgin (50 mg/ml), inj. amikacin sulphate (250 mg/ml), inj. amoxycillin sodium + tazobactum (3000 mg + 375 mg), inj. ampicillin (3 gm), inj. ampicillin + cloxacillin (1500 mg+ 1500 mg), inj. ampicillin+ cloxacillin (500 mg+ 500 mg), inj. b1+b2+b6+b12+ liver extract (10 mg+5 mg+100 mg+30 mcg + 0.66 ml/ ml), inj. b1+b2+b6+b12+niacinamide + d-panthenol + choline chloride ( 20 mg+ 1 mg+ 20 mg+ 200 mcg+ 20mg+ 10 mg+ 3 mg)/ ml, inj. buparvaquone (50 mg/ ml), inj. buserelin acetate (0.0042 mg/ml), inj. calcium borogluconate (25% w/v), inj. cefoparazone + tazobactum (3 g + 375 mg), inj. cefoparazone sod. + sulbactum sod. (3 g+ 1.5 g), inj. cefotaxime sod. (500 mg), inj. ceftriaxone + tazobactum (3000 mg + 375 mg), inj. ceftriaxone (3gm), inj. dextrose + sodium chloride + potasium chloride + calcium chloride + sodium lactate (20%+0.6g+0.04g+0.027g+0.312g), inj. diminazine diaceturate + phenazone (70 mg + 375 mg), inj. dinoprost tromethamine (5 mg/ ml), inj. doramectin (10 mg/ ml), inj. enrofloxacin (10%), inj. flunixin meglumine (equ. to flunixin 50 mg), inj. fortified procaine penicillin (40 lac), inj. gentamycin (40 mg/ml), inj. hydroxyprogesterone caproate (250 mg/ml), inj. isoflupredone 2mg/ml, inj. ivermectin (1% w/v), inj. levamisole hcl (75 mg/ ml ), inj. oxytetracycline (125 mg/ml), inj. oxytetracycline (50 mg/ml), inj. prostaglandin f2 (7.5%),

Nevirapine Tab Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government