Latest nitric acid hno3 Tenders | Government nitric acid hno3 Tenders

CTN :39986362

01 May, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of medical , drugs , surgical , syp , cream 2 propanol 45 gm 1 propanol 30 gm ethyl hexadecyl dimethyl ammonium ethyl sulphate point 2 gm with skin protecting substances 500 ml bott with dispenser, acyclovir ointment 3 percent w by w in 5 gm tube, adapalene point 1percent tube of 15 gm, adenosine 3 mg per ml 2 ml inj, alprazolam point 25 mg tab, amikacin sulphate 250mg per 2 ml inj, amiodarone hcl 150 mg 3 ml inj, amlodipine besylate 5 mg tab, amoxycillin 1g plus clavulanic acid 200mg 1 point 2 gm inj, amoxycillin 200 mg per 5ml plus clavulanic acid 28 point 5mg per 5ml syp in 30 ml bott, amoxycillin 500mg plus clavulanic acid 125mg tab, amoxycillin 875mg plus clavulanic acid 125mg tab, antacid chewable containing dried aluminium hydroxide ip 250mg mag hydroxide nf 250mg methyl polysiloxane 50mg tab, anti phlebitis cream tube of 15g oblique 20g, ascorbic acid 500 mg tab, aspirin 150 mg tab, aspirin 75 mg tab, atorvastatin 10 mg tab, atorvastatin 20 mg tab, atracurium 10 mg per ml 2 point 5 ml inj, b p cuff for adult, bandage crepe 10 cm, bandage crepe 15 cm, beclomethasone phenylephrine lignocaine cream tube of 20 gm, betahistine dihydro chloride 8mg tab, betamethasone dipropionate usp 0 pint 05mg and gentamycin sulphate 1mg per gm tube of 5gm, biomedical waste polythene bag black, biomedical waste polythene bag red, biomedical waste polythene bag yellow, bone wax, calamine 8 percent with 10 percent light liquid paraffin 50 ml bott, calcium 9mg plus calcium gluconate 50mg inj for iv use 10 ml injection, calcium carbonate 500mg tab elemental and vit d 3 200 iu to 250 iu tab, carboxy methyl cellulose 1 percent eye drop bid number/ & ( * ) : gem/2025/b/6117109 dated/ + : 10-04-2025 bid document/ 3 3 1 / 66

CTN :39992308

02 May, 2025 NA

Jamnagar - Gujarat

Tender For supply of expendable medical stores - levosalbutamol syrup 1 mg per 5ml bottle of 100 ml , fluoxetine hcl 20 mg cap , etophylline 115mg and theophylline 35 mg slow release form tab , cough sedative syp each 5 ml containing chlorpheniramine maleate 2 point 5mg guiaphenesin 100mg noscapine 15mg sodium citrate 60mg in flavoured base bott of 100 ml , vitamin b complex with a minimum concentration of vit b1 to 5mg vit b6 to 3mg and vit b12 to 5mcg therapeutic tab , calcium carbonate 500mg tab elemental and vit d3 tab , amoxycillin 200mg per 5ml clavulanic acid 28 point 5mg per 5ml syp in 30 ml bott , amoxycillin 1g clavulanic acid 200mg 1 point 2 gm inj , amoxycillin for oral susp containing amoxycillin base 125mg per 5 ml after reconstitution bottle of 30 ml , cefuroxime susp 125mg per 5ml bott of 30 ml , diclofenac 25 mg per ml ip 3ml inj , paracetamol syp 125 mg per 5ml bottle of 60 ml , pregabalin 75 mg methylcobalamine 1500 mcg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , mdi budecort budesonide , budesunide 1 mg respules , sitagliptin 50 mg metformin 500 mg tab , ondansetron 2mg ml 4 ml inj , ondansetron 8 mg tab , folic acid 5 mg tab , carvedilol 3 point 125mg tab , tab torsemide 10 mg , losartan 25 mg tab , losartan 50 mg tab , prazosin 2 point 5 mg sustained release slow release tab , ramipiril 5 mg tab , ramipiril 10 mg tab , adapalene 0 point 1 percent tube of 15 gm , fexofenadine 180 mg tab , mometasone 0 point 1 percent tube of 10 gm , minoxidil 5 percent lotion bott of 60 ml , tab levosulpride 25 mg , tab entecavir 0 point 5 mg , antacid gel each 5ml containing dried aluminium gel 250mg magnesium hydroxide 250mg and methyl polysiloxane 50mg bott of 170 ml , omeprazole 20 mg cap , pantoprazole 40mg inj , ranitidine 150 mg tab , tab dicyclomine 10mg , tab metformin sr 500 mg , tab metformin sr 1000 mg , sitagliptin 50 mg metformin 1000 mg tab , cefixime syp 50mg per 5ml bott of 30 ml , domperidone syp 1 mg per ml bott of 30 ml , ondansetron syp 2 mg per 5ml in bott of 30 ml , fluvoxamine 50 mg cap , ipratropium bromide respirator soln 500 mcg per 2 ml respule , levo salbutamol aerosol pack of 200 metered doses each metered dose supplies 50 mcg of levo salbutamol , levosalbutamol sulphate 2 point 5 ml containing 1point25 mg respule , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bott of 100 ml , cough expectorant syp 5 ml containing diphenhydramine hcl 14 point 08mg ammonium chloride 0 point 138 gm sodium citrate 57 point 03mg menthol 1point14 mg in flavoured syp base bott of 100ml , syp trebutaline phosphate 1 point 25 mg bromohexine hcl 4 mg guaiphesin 50 mg per 5 ml bott of 100 ml , antimicrobial hand gel containing ethyl alcohol 60 percent plus cyclomethicone c12 to15 alkyl lactate plus cetyl lactate plus phenoxyethanol plus stearyl alcohol with moisturizer , iron syp paediatric each 5 ml containing elemental iron 25 to 50 mg and folic acid 500mcg bottle of 200ml , amoxycillin 500mg plus clavulanic acid 125mg tab , ceftriaxone 1gm inj , cefixime 200 mg tab , zinc 10 mg per 5 ml syp , syp levosalbutamol 1mg per 5 ml bottle of 100 ml , anti venom serum polyvalent dry vial of 10 ml , diphtheria and tetanus vaccine ptap vial of 5 ml , typhoid vaccine 0 point 5 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , aceclofenac 100 mg plus paracetamol 500 mg tab , tab pantoprazole 40 mg plus domperidone 10 mg , syp diphenhydramine 10 to 15 mg per 5 ml and ammonium chloride 100 to 150 mg sodium citrate 50to85 mg per 5 ml bid details/ 2 / 112 bottle of 100 ml , nasal decongestant adult drops xylometazoline hcl 0 point 1 percent nasal drop bottle of 10 ml , azithromycin syp , naltrexone 50mg tab , diclofenac gel 1 percent tube of 30 gm , bandage open wove uncompressed 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , gauze surgical open wove unmedicated 60 cm x 3 metres packet , electrocardiograph paste or jelly bottle of 250 ml , bandage crepe 10

CTN :39970963

30 Apr, 2025 NA

Jorhat - Assam

Tender For supply of tab carbimazole 10mg , tab febuxostat 80mg , tab nifedipine 10 mg , tab sevelamer carbonate 800mg , tab acenocoumarol 3 mg , tab rifiximin 400 mg , inj tetanus toxide amp of 0.5ml single dose , tizanidine 2 mg tab , paracetamol 150mg per ml, 2 ml iv, inj , paracetamol 325mg and ibuprofen 400mg tab , ketorolac 10 mg tab , carbamazepine 200 mg tab , lorazepam 2mg per ml, 2 ml inj , diethylcarbamazine 50mg tab , tinidazole 500 mg tab , lenalidomide 10 mg tab , erythropoeitin human recombinant, 2000 iu , tab with ferrous fumarate with folic acid iron tab , carvedilol 12.5 mg tab , fenofibrate 200 mg tab , simvastatin 20mg tab , atenolol 25 mg tab , amlodipine besylate 5 mg tab , atenolol 50mg with amlodipine 5 mg tab , enalapril 5 mg tab , calamine powder , permethrin 5percentage tube of 30 gm , terbinafine hcl 1percentage lotion bottle of 20 ml , tretinoin 0.025percentage tube of 15gm , dicyclomine hcl 20mg inj , loperamide 2mg tab , doxylamine 10 mg with pyridoxine 10 mg tab , glimepiride 1mg tab , voglibose 0.2 mg tab , estriol 1 mg per gm cream tube of 15 mg , tab amino acid with antioxidant , tab alpha ketoanalogue of aminoacids , valganciclovir 450 mg tab , cream luliconazole, tube of 15 gm , betahistine dihydro chloride 8mg tab , cinnarizine 25 mg tab , clotrimazole 1percentage with lignocaine 2percentage ear drop 10ml , xylometazoline hcl 0.1percentage nasal drop,spray 10 ml , cefixime syp 50mg per5ml bott of 30 ml , cypropheptadine hcl 2 mg per5ml bott of 100 ml , promethazine hcl 25 mg tab , theophylline anhydrous syrup 60mg in 5ml as 100ml bottle. , n acetyl cysteine 600 mg, tab , etophylline 115mg and theophylline 35 mg in slow release form tab , syp diphenhydramine hydrochloride ammonium chloride, sodium citrate,menthol , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 100 ml , linezolid 600 mg tab , sildosin 4 mg tab , sildenafil citrate 50 mg tab , tamsulosin hcl 0.4mg cap , finasteride 5 mg tab , ascorbic acid 500 mg tab , vitamin b complex with vit b1 5mg, vit b6 3mg vit b12 5mcg tab , vit d3, 60,000 iu per 1gm sachet , vitamin e 200 mg cap bid details/ 2 / 49

State Government

CTN :39200933

19 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39920687

14 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of various chemicals - labchem acetic acid glacial ch3cooh , labchem acetone c3h6o , labchem ammonium acetate c2h7no2 , labchem ammonium chloride , labchem ammonium ferrous sulphate , labchem ammonium hydroxide nh4oh , labchem ammonium molybdate nh4 6mo7o , labchem boric acid h3bo3 , labchem edta c10h16n2o8 , labchem hydrochloric acid hcl , labchem hydrofluoric acid , labchem hydrogen peroxide , labchem bromocresol purple i c21h16br2o , labchem ebt indicator , labchem methyl orange indica c14h14n3na , labchem copper pan indicator c15h11n30 , labchem pr indicator c21h14n2o7 , labchem xylenol orange indic c31h32n2o1 , labchem sdps indicator , labchem iso propyl alcohol , labchem labolene cleaning r , labchem mercuric chloride , labchem methanol ch3oh , labchem orthophosphoric acid h3po4 , labchem oxalic acid c2h2o4 , labchem ph buffer tablets ph 4.00 , labchem ph buffer tablets ph 7.00 , labchem ph buffer tablets ph 9.20 , labchem potassium hydroxide koh , labchem quinoline , labchem silicon grease lubricant , labchem silver nitrate agno3 , labchem sodium bi carbonate nahco3 , labchem sodium meta bisulphite na2s2o5 , labchem sodium potassium tartrate , labchem sodium sulphate anhyhrous , labchem stannous chloride sncl2 , labchem stearic acid , labchem sulphuric acid h2so4 , labchem zinc acetate zn ch3co2 2 , labchem zinc oxide , labchem benzene , labchem glycerol 2.5 l ex , labchem methyl red indicator , labchem perchloric acid , labchem sodium nitrate , labchem sodium peroxide granular , labchem tin metal , labchem ammonium oxalate nh4 2c2o4 , labchem ammonium persulphate , labchem ammonium thiocyanate , labchem citric acid c6h8o7 , labchem dimethyl glyoxime c4h8n2o2 , labchem ethanol , chemical anhydrous ferric chloride fecl3 , labchem hydroxylamine hydrochloride , nisp project material bromocresol green , labchem potassium ferricyani k fe cn , labchem sodium bisulphite , labchem sodium fluoride anhydrous , labchem zinc sulphate hepta znso47h2o , labchem benzoin oxime , chromium oxide iii green 500 gm pack , carnauba wax , carborandum powder mesh 400 , carborandum powder mesh 800 , carborandum powder mesh 1000 , carborandum powder mesh 1200 , conductivity standard 12.88us cm , conductivity standard 1413us cm

CTN :39920812

25 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

Central Government And Public Sector

CTN :39896990

23 Apr, 2025 NA

Parganas - West Bengal

Tender For supply of 29 reagents for alcohol project - sodium tetraborate , trizma hydrochloride , tetraethyl orthosilicate , d plus glucuronolactone , sodium methoxide , perchloric acid seventy percent , hydrogen bromide solution in acetic acid , silver carbonate , barium hydroxide , sulfanilic acid , ammonium persulfate , aniline , acetyl chloride , sodium acetate anhydrous , 1 4 butanesultone , potassium tert butoxide , 3 pentadecylphenol , d glucuronic acid , sodium sulfide , ethyl alcohol pure , four methylumbelliferyl d glucuronide hydrate , four methylumbelliferyl phosphate chemical , ethyl beta d glucuronide solution , bovine serum albumin , human serum albumin , zinc sulphate heptahydrate , manganese ii chloride tetrahydrate , 3 mercaptopropyl triethoxysilane , cetyltrimethyl ammonium bromide ctab

CTN :39858766

18 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Nitric Acid Hno3 Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government And Public Sector

Central Government/Public Sector