Latest octane Tenders | Government octane Tenders

State Government

CTN :40001817

25 Apr, 2025 NA

Jodhpur - Rajasthan

Tender For tender for purcahse of stationery items on as & when required basis for the f.y.2025-26 - paper office a-4 , paper office fs , tags for file , pen (permanent marker) , pen ball cello , tape transparent 2" , pen t-max gel , refill pen t-max gel , pen gel octane , pen highlighter , pen white board marker , whitener/correcti on pen , duster classroom for , punching machine , pin stapler (big) , pin stapler (small) , pin paper (all pin) , pin u type pvc coated , drawing pin for notice board , tape brown 2", tape transparent 1" , index (kangaroo clip)munix file , chalk dustless (100 white chalk in a box) , eraser(rubber) , sharpener( pencil cutter) , pencil , file pad , glue (15gms) , stick , sticker sheet a/4 (100 sheets) , sticker sheet ast-16 100 sheets) ( , stapler (small) -10 , paper ruled for exam (dasta paper) , binder 19mm clip , binder 25mm clip , binder 32mm clip , register ruled 96 pages size-8"x13" , register ruled 144 pagessize-8"x13" , register ruled 192 pages size-8"x13" , rubber band big size , scale (ruler) plastic 12" , scissor small , scissor medium, scissor big , page , marker(sticky flag) , cutter , paper , medium , file , office , (printed logo) , nlu , envelopes white small 10"x4.5" , envelopes white big 10"x12" , envelope yellow 12"x10" , laminated , envelope , bubbled , type , size 12"x16" , answer copy 16 page, (midterm exam) hole at left side top corner , answer copy 16 , page, (supplementary exam) hole at left side top corner , answer copy 24 , page, (main , exam) ) hole at left side , top corner attendance , register students for , folder , conference multi , color 22x28/2 nlu sizc , printed , folder leather , executive quality for conference (mater & nlu logo printed), writing pad nlu printed 15 sheets , writing pad nlu printed 40 sheets , stay out pass for students (night out pass) , out pass students (day hours)

CTN :39920812

25 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

CTN :39912109

13 May, 2025 NA

Delhi - Delhi

Tender For purchase of vr kit items on two year rate contract basis-, brilliant blue g dye (indian), , -0.5% brilliant blue g dye, , #name?, , pf octane (pfcl) (indian), , perfluoro-n-octane liquid, , sterile solution, , silicone oil 1000cs (indian), , #name?, , viscosity 1000cst, , #name?, , silicone oil 5000cs, , (indian/imported), , purified silicone oil (ocular grade), , -viscosity 5000cst, , #name?, , silicon band (imported), , -silicon band -240 style-2.5mm wide, , -silicon band-241-3.5mm wide, , #name?, , silicon tire (imported), , -silicon tires-277 style -7mm wide, 2.5mmn groove symmetrical silicon tires-276 style -7mm wide, 2.5mm groove asymmetrical silicon tires-280 style -10mm wide, 2.5mm groove asymmetrical sterile packaging, , silicon tires-279 style -10mmn wide, 2.5mm groove symmetrical, , mvr 20g, , -mvr blade 20g for ophthalmic use, , #name?, , mvr 25 g, , -mvr blade 25g for ophthalmic use -sterile packaging, , mvr 23 g, , mvr blade 23g for ophthalmic use, , #name?, , injection brolucizumab, , -120 mg/ml for intravitreal injection, , injection ranibizumab pre-filled syringe (cdcso/dcgi approved), , -10 mg/ml for intravitreal injection a prefilled syringe for multiple retinal disorder like armd, diabetic macular oedema and retinal vascular occlusion and retinal vascular occlusion & retinopathy of prematurity injection ranibizumab (dcgi/ cdcso approve, , disposable 25g trocar and cannula (valved) with infusion line, , disposable 23g trocar and cannula (valved) with infusion line, , 41g - needle for subretinal injection (2mm), , chandelier 25g illuminator compatible with constellation vision system, , dual bore cannula for pfcl injection (25g), , dual retinal dye to stain both erm & ilm during vitreoretinal surgery (indian/imported), , injection aflibercept 2mg, , faricimab injection, , diamond dusted membrane scraper, ,

CTN :39530511

15 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various chemicals and fine chemicals, at skims, soura, srinagar on one year rate contract basis. - item specifications, 2-mercaptoethanol, absolute alcohol 99%, acetic acid, acetic acid glacial, acetone, acid fuchsin, acrylamide, alpha naphthol, alpha naphthylamine, ammonium acetate, ammonium chloride, ammonium persulphate, amyl alcohol, basic fuchsin, bis-acrylamide, bismark brown (powder), boric acid, bromophenol blue, calcium chloride, calcofluor white, carbol fuchsin (zn, strong), chloroform, conc. hydrochloric acid (hcl), conductive electrode paste/eeg paste, copper sulphate, crystal violet, diethyl pyrocarbonate (depc), dimethyl formamide, dimethyl sulfoxide (dmso), dimethyl-p-phenylene diamine dihydrogen chloride, dipotassium hydrogen phosphate, disodium edta, disodium hydrogen phosphate, dpc, dpx, edta dipotassium salt, eosin liquid, eosin powder, eosin y, ethanol 99%, ethedium bromide (etbr), ethyl alcohol, formaldehyde 37%, formic acid 85%, fungizone, giemsa stain, glycerol glycerin 98%, haematoxylin harris, hematoxylin (liquid), hematoxylin (powder), hydrochloric acid (98%), hydrogen peroxide (30%), hypochlorite solution (4%), iodine, isoamyl alcohol, isopropyl alcohol 99%, l pyrrolidonyl-b-naphthylamide, laboratory detergent, leishman s stain, liquid ammonia, lithium powder, magnesium chloride, magnesium citrate, magnesium sulphate, may grunwald stain (powder), mercuric oxide powder, methanol 99%, methyl red (powdered), methylated spirit, methylene blue (powdered), medical grade soda lime with following specifications: 1. should have high absorption capacity for carbon dioxide (more than 100 ltr/kg)2. should have low dust level.3. granule size 2.5-5.0 mm4. indicator pink to white., n acetyl l cysteine, n,n, dimethyl formamide, nigrosin, nitric acid 72%, para dimethyl amino benzaldehyde, para-dimethyl amino cinnamaldehyde, parafin oil (liquid), periodic acid, phenol, phenol (tris saturated), phosphate buffer saline capsules/tablets, potassium acetate, potassium bicarbonate, potassium chloride, potassium dichromate, potassium dihydrogen orthophosphllate, potassium dihydrogen phosphate na2hpo4, potassium ferro cyanide k4fe(cn), potassium hydroxide, potassium iodide, potassium permanganate, silver nitrate, skin preparation gel, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium deoxycholate, sodium dihydrogen orthophosphate, sodium dihydrogen phosphate, sodium dodecyl sulphate (sds), sodium hippurate, sodium hydroxide, sodium hypochlorite, sodium taurocholate, sucrose, sulfanilic acid, sulphuric acid, tetramethyl-p-phenylene diamine dihydrogen chloride, toluidine blue (powder), tris, tris hcl, urea (nh3conh2), xylene 98%

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39814395

15 Apr, 2025 NA

Kanpur - Uttar Pradesh

Tender For supply of sodium cyanide

corporations/Associations/Others

CTN :39816346

24 Apr, 2025 2.59 Lacs

Dewas - Madhya Pradesh

Tender For supply of stationery items - u pin , box file , octane gel ss , uniball zero point 5 mm , ball pen , pen use and throw , pencil , pen stand , cd marker , eraser , fevistik , duster , l folder , sticky notes , file flag , transparent tape 2 inch , tranparent tape 1 inch , highlighter , punching machinedouble , punching machine single , paper cutter plastic , paper weight , plastic scale 15 , permanent marker , poker , add gel pen , binder clip , stamp pad small , stapler , stapler big , stapler pin 10 number , scissor , spiral note pad , white board marker , pin holder , file tag , damper , calculator , brown tape 2 inch , fevicol 100 gm , button file , permanent marker ink

CTN :39776007

15 Apr, 2025 NA

Visakhapatnam - Andhra Pradesh

Tender For supply of nma based non - metallic octane booster (v2) (nrl) (q3)

Octane Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

corporations/Associations/Others