Oligo Synthesis Tenders

Get complete information related to latest Oligo Synthesis Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Oligo Synthesis Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Oligo Synthesis Tenders .

Filter

Loading....

Get Tender in Email

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

Central Government And Public Sector

CTN :39711374

29 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For corrigendum : tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spar

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Oligo Synthesis Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government/Public Sector