Latest organophos Tenders | Government organophos Tenders

Central Government / Public Sector

CTN :39216448

20 Feb, 2025 NA

Sambalpur - Odisha

Tender For supply of inhibitor corrosion and "b" check material, make- cummins india limited only.

Central Government/Public Sector

CTN :39218404

13 Feb, 2025 NA

Mangalore - Karnataka

Tender For quotation for chemicals & materials- magnetic stirrer 5 liter capacity with hot plate and digital speed indicator , round bottom flask, narrow mouth, short neck with i/c joint 500ml, 24/29 , liebig condenser with drip tip 300mm ground jointsocket : 24/29 cone: 24/29 , connection tubes, t-shape 50mmx8mm , round bottom flask 2 necks, parallel 500ml centre neck : 24/29, side neck: 24/29 (if not available 19/26) , receiver bent adapter, 24/29 , ferric nitrate nonahydrate, 500gm , ferric chloride anhydrous, 500gm , thermal insulation gloves or furnace gloves (in pairs), large , methanol, 2.5ltr , single use plastic petri dishes, 500/pk , potassium sodium tartarate tetrahydrate 98% ep, 500gm , sodium phosphate dibasic anhydrous 98% ep, 500gm , iso-octane ar, 99.5% 2500ml , glacial acetic acid 99.5% ep 2500ml , potassium iodide 99% pure, 500gm , potassium permanganate 99.5% ar, 500gm , bradford reagent for proteins, 500ml , ph tablet - 4 , 10/pk , ph tablet - 7 , 10/pk , ph tablet - 9.2 , 10/pk , silica gel -self indicating for dessicator, 500gm , gelatin from porcine skin gel strength 300, type a, 100gm , methacrylic anhydride contains 2,000ppm topanol a as inhibitor >98% , carbonate-bicarbonate buffer capsule , n,n dimethylformamide 99% for synthesis, 2500ml , 1,10 phenanthroline monohydrate99% ar/acs 25gm , methylene blue m.s (dye 82%), 25gm , 3,3',5,5'-tetramethyl benzidine 99%, 5gm , zinc nitrate hexahydrate 96% ep, 500gm , sodium hydroxide powder 97% ep, 500gm , glutathione reduced 99% for biochemistry, 25gm , pectin ep, 100gm , hydrazine hydrate 80%, 500ml , dialysis membrane-110 5mt , sodium dihydrogen orthophosphate monohydrate 99% ar, 500gm , sodium phosphate dibasic anhydrous 98% ep, 500gm , hydrogen peroxide solution 30%, 2500ml , polyethylene glycol 200 500ml , calcium chloride fused 90% 500gm , methylimidazole 98% ep, 100gm , cerous nitrate hexahydrate 99.9% ar, 100gm , receiver bent adapter,joint: 24/29 cone : 24/29

CTN :39218663

12 Feb, 2025 NA

Kochi - Kerala

Tender For six months rate contract for manpower assitance for chemical/inhibitor filling at petchem, bpcl kochi refinery

Central Government/Public Sector

CTN :39222221

27 Feb, 2025 1.67 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of broom country , cleaner white toilet harpic , cloth sponge , cloth stocknite mutton cloth , feather broom phool jhadu , duster cloth , polish metal brass , super spin mop refils , brush sweeping hand , cotton waste , abrasive cleaning pad scrabber pad , scrubber with handle , brush with long handle , cleaning bar for utensils 500 gms , cotton rags , wiper long handle , spin mop set , steel cleaning liquid , hand towel , cleaning liquid for utensils , disinfectant fluid white black phenoil , glasscleaner 500 ml , hand wash liquid , pest seal hit spray , room freshner room spray , soap liquid toilet , deodriser refill for ship head 8 cm x 3 cm , detergent powder , dust bin , biodegradable garbage bags gash bags , mug plastics , napthalene balls , distilled water , ncml solution thiourea , ncml solution oxalic acid , ncml solution phosphoric acid , ncml solution teepol , rat sticking gel , refill for automatic air freshner 250 ml , mosquito repellent machine with liquid , spray hand liquid insecticide , fiber dust brush , paint brush 2 inch , paint brush 4 inch , paint roller 6 inch , paint roller 9 inch , clip jubilee 3 inch , distemper white , paint roller 7 inch , paint roller 4 inch , brown sheet laminated , photo copier paper 210 mm x 297 mm a4 , toilet paper , photo copper paper 210mm x 325mm fs , envelope size 4 x 10 , envelope size 6 x 12 , envelope size 10 x 14 , envelope cloth coated 9 x 12 , envelope cloth coated 10 x 14 , envelope cloth coated 12 x 16 , dvd , tape transparent 1 inch , tape transparent 2 inch , antirust spray , wonder tape 2 inch , tape insulation 25 mm steel grip , teflon tape , candle wax , photocopier paper a3 , paper napkin , telephone cable 4 core , abrasive paper 230 mm x 280 mm , safety gloves cloth , m seal , pencil cell 1.5 v aaa , wet surface putty , quick dry steel putty , aqua bond , door mat foot mat floor synthetic , bag gunny , can plastig 10 ltrs , jerry cans 20 ltrs , biodegradable polythene film width 18 thick 0.007 , corrosion inhibitor , battery aa 1.5v , varnish touch wood , lamp cfl led , tube flourescent led cfl , torch cell 1. 5 v medium size bid details/ 2 / 65

Central Government/Public Sector

CTN :39222226

27 Feb, 2025 1.68 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of broom country , cleaner white toilet harpic , cloth sponge , cloth stocknite mutton cloth , feather broom phool jhadu , duster cloth , polish metal brass , super spin mop refils , brush sweeping hand , cotton waste , abrasive cleaning pad scrabber pad , scrubber with handle , brush with long handle , cleaning bar for utensils 500 gms , cotton rags , wiper long handle , spin mop set , steel cleaning liquid , hand towel , cleaning liquid for utensils , disinfectant fluid white black phenoil , glass cleaner 500 ml , hand wash liquid , pest seal hit spray , room freshner room spray , soap liquid toilet , deodriser refill for ship head 8 cm x 3 cm , detergent powder , dust bin , biodegradable garbage bags gash bags , mug plastics , napthalene balls , distilled water , ncml solution thiourea , ncml solution oxalic acid , ncml solution phosphoric acid , ncml solution teepol , rat sticking gel , refill for automatic air freshner 250 ml , mosquito repellent machine with liquid , spray hand liquid insecticide , fiber dust brush , paint brush 2 inch , paint brush 4 inch , paint roller 6 inch , paint roller 9 inch , clip jubilee 3 inch , distemper white , paint roller 7 inch , paint roller 4 inch , brown sheet laminated , photo copier paper 210 mm x 297 mm a4 , toilet paper , photo copper paper 210mm x 325mm fs , envelope size 4 x 10 , envelope size 6 x 12 , envelope size 10 x 14 , envelope cloth coated 9 x 12 , envelope cloth coated 10 x 14 , envelope cloth coated 12 x 16 , dvd , tape transparent 1 inch , tape transparent 2 inch , antirust spray , wonder tape 2 inch , tape insulation 25 mm steel grip , teflon tape , candle wax , photocopier paper a3 , paper napkin , telephone cable 4 core , abrasive paper 230 mm x 280 mm , safety gloves cloth , m seal , pencil cell 1.5 v aaa , wet surface putty , quick dry steel putty , aqua bond , door mat foot mat floor synthetic , bag gunny , can plastig 10 ltrs , jerry cans 20 ltrs , biodegradable polythene film width 18 thick 0.007 , corrosion inhibitor , battery aa 1.5v , varnish touch wood , lamp cfl led , tube flourescent led cfl , torch cell 1. 5 v medium size bid details/ 2 / 65

Central Government/Public Sector

CTN :39222263

27 Feb, 2025 1.69 Lacs

Ramanathapuram - Tamil Nadu

Tender For supply of broom country , cleaner white toilet harpic , cloth sponge , cloth stocknite mutton cloth , feather broom phool jhadu , duster cloth , polish metal brass , super spin mop refils , brush sweeping hand , cotton waste , abrasive cleaning pad scrabber pad , scrubber with handle , brush with long handle , cleaning bar for utensils 500 gms , cotton rags , wiper long handle , spin mop set , steel cleaning liquid , hand towel , cleaning liquid for utensils , disinfectant fluid white black phenoil , glass clenaer 500 ml , hand wash liquid , pest seal hit spray , room freshner room spray , soap liquid toilet , deodriser refill for ship head 8 cm x 3 cm , detergent powder , dust bin , biodegradable garbage bags gash bags , mug plastics , napthalene balls , distilled water , ncml solution thiourea , ncml solution oxalic acid , ncml solution phosphoric acid , ncml solution teepol , rat sticking gel , refill for automatic air freshner 250 ml , mosquito repellent machine with liquid , spray hand liquid insecticide , fiber dust brush , paint brush 2 inch , paint brush 4 inch , paint roller 6 inch , paint roller 9 inch , clip jubilee 3 inch , distemper white , paint roller 7 inch , paint roller 4 inch , brown sheet laminated , photo copier paper 210 mm x 297 mm a4 , toilet paper , photo copper paper 210mm x 325mm fs , envelope size 4 x 10 , envelope size 6 x 12 , envelope size 10 x 14 , envelope cloth coated 9 x 12 , envelope cloth coated 10 x 14 , envelope cloth coated 12 x 16 , dvd , tape transparent 1 inch , tape transparent 2 inch , antirust spray , wonder tape 2 inch , tape insulation 25 mm steel grip , teflon tape , candle wax , photocopier paper a3 , paper napkin , telephone cable 4 core , abrasive paper 230 mm x 280 mm , safety gloves cloth , m seal , pencil cell 1.5 v aaa , wet surface putty , quick dry steel putty , aqua bond , door mat foot mat floor synthetic , bag gunny , can plastig 10 ltrs , jerry cans 20 ltrs , biodegradable polythene film width 18 thick 0.007 , corrosion inhibitor , battery aa 1.5v , varnish touch wood , lamp cfl led , tube flourescent led cfl , torch cell 1. 5 v medium size bid details/ 2 / 65

CTN :39224239

26 Feb, 2025 NA

Visakhapatnam - Andhra Pradesh

Tender For supply of corrossion&scale inhibitor, vrmp scw , polymeric dispersant, scw, asprtc acid, 25% , non oxidising biocide, vrmp scw, amine bsd

Central Government/Public Sector

CTN :39188588

25 Feb, 2025 NA

Kalka - Haryana

Tender For supply of inhibitor corrosion , coolant premix eg 50 : 50 to cil pt. no. 3816981 for cummins engi ne model vta-28-l or fleetgaurd compleat eg 50:50 premix to fleetgaurd part no cc2774. [ warranty period: 36 months after the date of delivery ]

Central Government/Public Sector

CTN :39195678

24 Feb, 2025 NA

Rupnagar - Punjab

Tender For supply of fam labelled mirna let 7b 5p mimic (hsa let 7b 5p) mature mirna sequence ugagguaguagguugugugguu, 100 , mirna let 7b 5p inhibitor mature mirna sequence ugagguaguagguugugugguu, 100 nm , mirna let 7b 5p mimic (hsa let 7b 5p) mature mirna sequence ugagguaguagguugugugguu, 100 nm

State Government

CTN :39187144

08 Feb, 2025 NA

Kolkata - West Bengal

Tender For quotation for fbs:eu origin, 500ml, protease inhibitor, 1ml, 100bp dna ladder, 200 ln, agarose, 500g, hipura pcr, 50pr and agar agar, 500g

Organophos Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors