Latest paraformaldehyde Tenders | Government paraformaldehyde Tenders

CTN :40004777

03 May, 2025 13.67 Lacs

Dibrugarh - Assam

Tender For supply of bott of 30 ml , cap fluoxetine hcl 20 mg , tab nor ethisterone 5mg , respules levosalbutamol sulphate 2.5 ml containing 1.25 mg , inj cefoperazone sodium 1gm sulbactum sodium 1gm , tab sulphamethoxazole 400 mg trimethoprim 80mg , inj nitroglycerine and glyceryltrinitrate 5 mg , injectable typhoid vaccine , tab l carnitine coenzyme q10 zinc lycopene and astaxanthin , syp terbutaline sulphate bromphexine hcl 4 mg guaphenesin 50 mg , powder dextrose monohydrate for oral use pkt of 100gm , povidone iodine 7.5 percent solution of 100ml , inj sodium bicarbonate 7.5 percent amp of 10 ml , drop vitamin d3 cholecalciferol ip 400iu drop of 15ml , syp levocetrizine dihydrochloride 25mg montelukast 4 mg bott of 60 ml , tab clindamycin clotrimazole tinidazole vaginal pessaries , tab oxybutanin 2.5mg , cap cyclosporine 250mg , prebiotic probiotic sachet , syp fungal diastase with carminatives vitazyme , syp metronidazole 200 mg per 5ml bott of 60 ml , tab cilnidipine 5 mg , tab cilnidipine 10 mg , tab cilnidipine 20 mg , syp zinc 20 mg per 5 ml bott of 100 ml , tab fluconazole 150mg azithromycin 1000mg secnidazole 1000mg fas kit , tab clomiphene citrate 25 mg , tab nifedipine retard 20 mg , inj alteplase 50mg , tab efavirenz 600 mg , tab tenofovir 300 mg lamivudine 300 mg dolutegravir 50 mg , tab 5 amino salicylic acid 1.2 gm mesacol , tab cabergoline 0.5mg , sodium chloride 3 percent bott of 100ml , inj dexmeditomedine 100 mcg , tab aspirin 75 mg , tab fexofenadine 120mg montelukast 10mg , tab clotrimazole vaginal pessary 100mg , diclofenac sodium suppository 100 mg , bisacodyl suppositories , paracetamol suppository , oint traclolimus 0.1 percent tube of 10gm , human diploid cell rabies vaccine , mva syringe set with cannula , troponium t test card kit , tab h pylori kit lansoprazole tinidazole clarithromycin , tab paraformaldehyde , inj etomidate 2 mg per ml 10 ml amp , levonorgestrel iud mirena , amniotony hook , tab metformin sr 500 mg glimepride 2mg voglibose 0.2mg tab tramadol hcl 50 mg , tab montelukast 10 mg levocetrizine 5mg , inj hydrocortisone sodium succininate 100 mg, tab diclofenac sodium 50mg paracetamol 325mg chlorzoxazone 500mg, respules budesonide 1mg, tab amitriptyline 25 mg, inj bupivacaine hcl inj 5mg per ml heavy amp of 4 ml, tab pyrazinamide 1500 mg , tab itraconazole 100mg, tab azathioprine 50mg , inj methyl prednisolone sodium succinate inj 1000mg, inj lignocaine hcl 2percent with adrenaline1 80000 of 30 ml, inj ondansetron 8mg , tab medroxy progesterone 10 mg, tab folic acid 5 mg, inj tranexamic acid 500 mg per 5ml, tab common cold cetrizine 5 mg paracetamol 500 mg pseudoephedrine 60 mg, tab naproxen 250mg, chlorhexidine mouthwash 0.2percent bott of 100 ml, oint framycetin sulphate cream bp 1percent 20 gm, oint mupirocin 2 percent tube of 5 gm, oint povidone iodine 10 percent, oint terbinafine 1percent tube of 10 gm, inj frusemide 20 mg in amp of 2 ml, inj lignocaine hcl solution 2 percent for iv vial of 50 ml, inj tenecteplase 40mg , inj octreotide inj 0.1mg per ml , tab antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg, tab trypsin with chymotrypsin, enema sodium phoshate ml 6 percent sod acid phoshate 16percent pack of 100ml , inj metoprolol 1 mg per ml amp of 5 ml, inj labetalol hcl 5 mg per 5 ml , tab thyroxine sodium 0.025 mg , tab thyroxine sodium 0.1mg , inj neostigmine 0.5 mg in 1 ml , tab natural micronised progesterone 100 mg , dinoprostone gel 0.5mg bid details/ 2 / 75

CTN :39986166

01 May, 2025 NA

Gaya - Bihar

Tender For supply of ketamine hcl 50 mg per ml 2 ml inj , vitamin b complex with a minimum concentration of vit b1 5mg vit b6 3mg and vit b12 5mcg therapeutic tab cap , diclofenac sr 100 mg tab , tab pramipexole 0 point 25 mg , povidone iodine solution 5 percent bottle of 100 ml , tab epleronone 25 mg , tab olanzapine 10mg , syp multivitamin drops with constituents having vit a vit b1 b2 b6 vit c vit d bottle of 15ml osages as per recommended daily allowances , tab rosuvastatin 20 mg , diclofenac diethylamine 2 point 32 percent spray for tofical use , inj phytomenadione vit k 1 mg per 0 point 5 ml , inj esmolol 100 mg 10ml , tab rabeprazole 20 mg , inj benzathine penicillin i p 600000 i u , tab trimetazidine mr 35 mg , tab etoricoxib 120 mg , tab indomethacin 75 mg sr tab , tab ketorolac 10mg tab , tab tramadol hcl 50 mg , succinylchloline chloride 50 mg per ml 2 ml inj , tab dexamethasone 0 point 5 mg , inj pralidoxine 500 mg per 20ml , tab clofazimine 100mg , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , tab trihexyphenidyl hcl 2 mg , tab ethamsylate 250mg , gamma benzene hexachloride 1 percent w by v cetrimide 0 point 1 percent w by v in alcoholic solution , ciprofloxacin hcl 0 point 3 perent plus dexamethasone 0 point 1 percent bott of 5ml , tab glyceryl trinitrate cr 2 point 6 mg , tab thyroxine sodium 75 mcg , tab voglibose 0 point 3 mg , tab digoxin 0 point 25 mg , tab clonidine 100mcg , bisoprolol 5 mg tab , human insulin analogue glargine inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen , tab nebivolol 50 mg , antibiotic ointment each gm containing polymyxin b sulphate 5000 units zinc bacitracin 400 units neomycin sulphate 3400 units 5gm ointment , tab minocycline 100 mg , tab paraformaldehyde , tab antispasmodic containing mefenamic acid 250 mg and dicyclomine hcl 10mg , lactic acid bacillus sachet , hydrocortisone enema 10 percent w by w , tab bisacodyi 5mg , liquid paraffin in bottle of 100 ml , misoprostrol 25 mcg tab , tab isoxsuprine 10mg , estradiol valerate 2mg tab pack of 28 , sevelamer 400mg tab , ciprofloxacin hcl 0 point 3 percent tube of 5 gm , cyclopentolate hcl 1 percent opth soln bottle of 5 ml , cream luliconazole tube of 15 gm , dexamethasone sodium phosphate 1 percent and tobramycin 0 point 3 percent w by w oint tube of 3 point 5gm , beclomethasone dipropionate nasal spray 50 mcg per dose metered dose 150 units , chlorpromazine 25mg tab , tab amisulpride 200mg , dextrose 50 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , multi vit inj iv 2 10 ml with minimum constituents having thiamine b1 30mg per ml pyridoxine b6 30mg per ml and b12 cyanocobalamin 300 mcg per ml , capsacain gel tube of 20 gm , leflunomide tab 10 mg , nitrofurantoin 100 mg tab , eye drop brimonidine 0 point 2 percent plus brinzolamide 1 percent bottle of 5 ml , inj nitroglycerine 5 mg , tab semaglutide 3 mg , tab misoprostol 200mcg , inj tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , tab natural micronised progesterone 200mg , tab esomeprazole 40 mg plus levosulpride 75 mg , salmeterol 25 mcg plus fluticasone 250 mcg autohaler bid details/ 2 / 58

CTN :39986512

01 May, 2025 NA

Ahmedabad - Gujarat

Tender For supply of acenocoumarol 1 mg tab , phytomenadione vit k 1 mg per 0 point 5 ml inj , rivaroxaban 20 mg tab , fenofibrate 160 mg tab , pentoxifylline 400 mg tab , vitamin k 10 mg comma amp of 1 ml , bosentan 62 point 5 mg comma tab , tab perindopril 8mg , simvastatin 20mg tab , adenosine 3 mg slash ml comma 2 ml inj , amiodarone hcl 150 mg comma 3 ml inj , esmolol 100 mg comma 10 ml inj , prasugrel hcl 5 mg tab , nebivolol 5 mg tab , labetalol hcl 100 mg tab , tab propranolol tr 40 mg , vasopressin 20 units per ml inj comma 1ml ampoule , hydrochlorothiazide 25mg , ramipiril 5 mg plus hydrochlorothiazide 12 point 5 mg tab , povidine ioddine 2 percent gargles bott of 100 ml , paraformaldehyde tab , tab dutasteride 0 point 5 mg , mannitol 20 percent inj comma bottle of 350 ml , torsemide 20 mg tab , rifaximin 550 mg cap , tab levosulpiride 25 mg , tab entacavir 0point 5 mg , mebeverine hcl 135 mg tab , enema sodium phosphate 6 percent comma sodium acid phosphate 16 percent comma pack of 100 ml , glycerine suppositories child size 2g mould , isapgol slash ispaghula husk 3 point 5 gm , rebeprazole 20 mg plus domperidone 30 mg sustained release tab , loperamide 2mg tab , purified fsh 75 iu inj , carboprost tromethamine 250 mcg slash ml 1ml inj , clomiphene citrate 50 mg tab , doxylamine succinate 10mg usp plus pyridoxine hydrochloride 10 mg ip tab , oestrogen conjugated 0 point 625mg tab , human chorionic gonadotrophin 2000 iu inj , pyridostigmine 60 mg tab , succinylchloline chloride 50 mg slash ml comma 2 ml inj , cap tacrolimus 1 mg prolonged release , tab solifenacin 5 mg , calcium acetate 500 mg tab , tacrolimus 0 point 5mg cap , sevelamer 400 mg tab , tab l dash carnitine 500 mg , phenobarbitone syp 20 mg per 5 ml bott of 60 ml , natural surfactant 25 to 80mg per ml inj , human milk fortifier 2 gm sachet , bupropion hcl 150 mg sr tab , buspirone hcl 10 mg tab , agomelatine 25 mg tab , cap doxepin 25 mg , clozapine 100 mg tab , fluvoxamine 50 mg cap , desvenlafaxine 50 mg tab , etizolam 1 point 5 mg tab , olanzapine 5 mg tab , trazodone 50 mg tab , venlafaxine 75 mg tab , venlafaxine 37 poiint 5 mg tab , paliperidone palmitate 75 mg inj , quetiapine 25 mg tab , seroflo 250 syncyobreathe mdi salmetrol 25 mcg as salmetrol xinafoate ip fluticasone propionate ip 250 mcg , pirfenidone 200 mg tab , potassium chloride liquid 20 percent bott of 200 ml , micronised purified flavonoid fraction 1000 mg daflon 1000 , enteral feed powder comma protein 85 percent comma short chain peptides fat carbohydrate malto destri sachet of 126 gm to 200 gm protein powder , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , calcium 9 mg plus calcium gluconate 50 mg inj for iv use comma 10 ml injection , methyl prednisolone sodium acetate 80 mg inj , leflunomide 10 mg tab , inj benzathine penicillin i.p dot 600000 i dot u , artemether 80 mg comma lumefantrine 480 mg tablet , clindamycin 300 mg cap , emtricitabine 200 mg plus tenofovir 300 mg tab , nevirapine 200 mg tab , zidovudine 300 mg plus lamivudine 150 mg plus nevirapine 200 mg tab , oseltamivir 75 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5 mg tab , carvedilol 6 point 25 mg tab , calcium acetate 667 mg tab , melatonin 3 mg tab , prednisalone 10 mg tab , clindamycin 600 mg injection 150 mg per ml of 4 ml , piroxicam 40 mg comma 2 ml inj , indomethacin 25 mg tab slash cap , phenobarbitone 30 mg tab , grieseofulvin 500 mg tab , bromocriptine 2 point 5 mg tab , erythropoetin human recombinant comma 2000 iu slash ml point 1 ml inj , lignocaine hcl sol 2 bid details/ 2 / 155 percent for iv use comma 50 ml inj , enalapril maleate 10 mg tab , streptokinase 15 lacs iu inj , menotrophin 75u fsh plus 75ulh inj , thalidomide 100 mg , pioglitasone hcl 15 mg tab , imipramine 25 mg tab , tiptropium bromide 18 mcg dry powder cap , bromohexine syp 5 ml containing 4 mg of bromohexine hcl bott of 100 dash 150 ml , cough lozenges each containing noscapine 10 mg , leflunomide 20 mg tab , budesonide mdi 100u

State Government

CTN :39774838

19 Apr, 2025 NA

Thiruvananthapuram - Kerala

Tender For corrigendum : supply of multidishes tissue culture 4 wells - multidihestissueculture , silvertrate , acetone , highglucosedmem , collagenasetypeii , paraformaldehyde , glutaraldehyde , cd31 antibody , cd44antibodymousemonoclonal

CTN :39920471

25 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of grna synthesis , crispr oblique cas9 plasmid containing selectable marker for grna delivery , mouse hematopoietic stem cell isolation kit with magnet , mptp hydrochloride 100mg , rabbit anti mouse sca-1 antibody for icc , paraformaldehyde powder 500gm , poly-l-lysine solution 100 ml , dapi 10 mg , dpx mountant for histology 100 ml , cas9 protein 250ug

Central Government/Public Sector

CTN :39964913

29 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of ammonia solution 30percent grade analytical reagent pack size 5 ltr , hydrochloric acid 35percent ar grade pack size 5 ltr with coa , nitric acid ar grade 69percent pure pack size 2.5 ltr with coa , ammonium bifluoride ar grade with coa , starch soluble ar grade with coa , ordinary filter paper125mm dia grade101 100 circle per pack , filter paper no 40ashless dia12.5cm 100 circles per box , beaker griffen low form with spout 250ml isi marked , air heater heating element 5kw 230by400 cuni 2inch bsp flange.ihcu 50by32 depth of immerson 320mm , perchloric acid ar grade min.70percent assay packing 2.5 litre in glass bottle with coa , apron cotton white colour medium sixe full hand , apron cotton white colour large full hand , apron cotton white colur xl full hand , apron cotton khakhi colur large size half hand , apron cotton khakhi colur xl size half hand , respirators mask model v 44 is 9473 2002 ffp1s , drill bit size 4mm moc carbide tipped , rubber hand gloves 11 inch acid proof for handling conc. acid , copper standard solution 1000 ppm 500 ml for aas use , carbondaum black silicon carbide bench grinding wheel size bore 32mm od 150mm thickness 20mm , muffle furnace fire safety hand gloves made of 575 gsm aluminized para armid heat resistant fabric.11612 2008. heat resistant up to 1000 deg c. size 14inch

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Paraformaldehyde Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector