Latest phosphatidylcholine Tenders | Government phosphatidylcholine Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39816530

15 Apr, 2025 NA

Ambala - Haryana

Tender For supply of tab ropinirole 2mg , tab rosuvastatin 10mg , tab rosuvastatin 20mg , tab rosuvastatin 40mg , tab s amlodipine 2 point 5mg , tab s-adenosyl l methionine 200mg , tab salbutamol 4mg , tab serratiopeptidase 10mg , tab sildenafil citrate 25mg , tab sitagliptin phosphate 50mg , tab sodium bicarbonate 1000mg , tab sodium valproate cr 200mg , tab sodium valproate cr 300mg , tab solifenacin 10mg , tab tadalfil 20mg , tab tamsulosin 0 point 4mg plus dutasteride 0 point 5mg , tab telmisartan 20mg , tab telmisartan 40mg plus amlodipine 5mg , tab telmisartan 80mg , tab tenaligliptin 20mg , tab thiocolchicoside 4mg , tab thyroxin sodium 12 point 5mcg , tab tolvaptan 30mg , tab torsemide 20mg , tab trimetazidine 20mg , tab trimetazidine mr 35mg , tab valacyclovir 1gm , tab verapamil 40mg , tab voglibose 0 point 3mg , tab warfarin 1mg , tab zinc plus multivitamin , eye drop moxifloxacin hydrochloride and dexamethasone phsphate opthalmic solution with droptainer sysytem with 10 ml equivalent to moxifloxacin 5mg and dexamethasone 1mg in 1ml , inj filgrastim 300mcg , tab methyl prednisolone 8mg , tab capacitabine 500mg , cap lenvatinib 4mg , tab cabozantinib 40mg bid number/ & ( * ) : gem/2025/b/6084787 dated/ + : 25-03-2025 bid document/ 2 2 1 / 32

CTN :39320124

26 Mar, 2025 12.37 Lacs

Nashik - Maharashtra

Tender For bid to ras supply of paracetamol syp 125 mg 5 ml bottle of 60 ml , syrup calcium phosphate 80 mg 5 ml 200 ml bottle , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bott of 100 ml , chlorhexidine mouth gel hexigel , ibuprofenplusparacetamol syrup , clove oil bott of 50 ml , chlorhexidine mouth wash with 0dot12percent sugar alcohol free bottle of , glycerin glycerol 100 ml , calamine lotion , salicylic acid 3 5percent and coal tar 1 3percent soln bott , cetirizine syp 5mg 5ml bott of 60 ml , cypropheptadine hcl 2 mg 5ml bott of 100 ml , sucralfate suspension 1gm 10ml plusoxetacaine 10 mg 10ml bott of 200 ml , disodium hydrogen phosphate syrup , povidone iodine 10percent solution bott of 100 ml , iron syp paediatric each 5 ml containing elemental iron 25 50 mg and , metronidazole inj for iv use containing 500mg per bott of 100 ml , cough expectorant syp 5 ml containing diphenhydramine hcl 14dot08mg , cremaffine white each 15 ml containing milk of magnesia , grillintus dextromethorphan hbr 5 mg chlorpheniramine maleate2dot5 mg , povidone iodine 2percent gargle bott of 100 ml , multivitamin syrup bott of 200 ml , syp iron plus folic acid , levetiracetam 100 mg ml syr soln liquid bottle of 100 ml , sodium valproate oral solution 200 mg 5ml bott of 100 ml , albendazole syp each 5 ml containing 200 mg bott of 10 ml , antiseptic mouth wash containing sodium fluoride and triclosan bott of 100 ml , b complex with zinc syp , permethrin 5percent tube of 30 gm , lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzl , cream silver sulphadiazine1percent tube of 25 gm , choline salicylate and benzalkonium chloride gel of 10 ml , desensitising paste stannous fluoride sodium monofluoro phopsphate , adapalene 0dot1percent tube of 15 gm , 0dot05percent halobetasol propionate plus 3percent salicylic acid ointment , 0dot05percent halobetasol propionate ointment , clindamycin phosphate 1percent topical gel tube of 10 gm , clobetasol propionate cream 0dot05percent in tube of 10 gm , clotrimazole cream 1percent tube of 15 gm , framycetin sulphate cream bp 1percent cream 20 gms , hydroquinone 2percent tube of 50 gm , terbinafine 1percent cream tube of 10 gm , tretinoin 0dot025percent tube of 15 gm , tretinoin 0dot05percent tube of 20 gm , conjugated estradiol 0dot625 mg per gm tube of 15 gm plus applicator , fluticasone propionate cream 0dot05percent tube of 10gm , diclofenac gel 1percent tube of 30 gm , clobetasole propionate 5percent plus gentamycin 5percent plus miconazole 2 percent tube of 20 gm , clotrimazole 2percent vaginal gel , combiflam ointment methyl salisylate 30percentplusmenthol10percen , hydroxypropyl methylcelluse eye gel genteal gel , luliconazole 1percent topical cream oint , methylsalicylateplusmentholpluscamphor cream , triamcinolone acetonide 0dot1percent tube of 5 gm , clobetasol and salicylic acid cream , clotrimazole vaginal pessary 100mg , povidone iodine 200 mcm pessary , fusidic acid cream 2 percent w w 10 g tube , nimesulide gel tube of 20 gm , povidone iodine skin oint , budesunide 1 mg respules , salmeterol 25 mcg plus fluticasone 250 mcg autohaler , salmetrol 25 mcg plus fluticasone 125mg mdi 120 doses , glycopyrronium and inhalation solution 25 mcg 5 respules of 2 ml each , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per , ipratropium bromide respirator soln 500 mcg 2 ml respule , tiotropium bromide 9 mcg 120 metered doses unit inh , tiotropium bromide 18 mcg and formoterol 12 mcg dry powder no rotacaps , formeterol 6 mcg and budesonide 400 mcg cfc free rotacaps , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inh of 60 , formoterol 12mcg plus budesonide 400mcg inhaler , salmeterol 25mcgplusfluticasone propionate 50mcg inhaler seroflo 50 inhaler , budesonide 160 mcg formoterol fumarate dihydrate 4dot5 mcg symbicort , glycopyrronium 25mcg respules glycohale , ciclesonide 200mcgplusformoterol 6mcgplustiotropium 9mcg inhaler trimium , mesalazine 1gm sachet ,

CTN :39498760

26 Mar, 2025 NA

Ganganagar - Rajasthan

Tender For bid to ras bid to ras tender for supply of folic acid 5 mg , formoterol 6 mcg plus budesonide 200 mcg mdi inhaler , formoterol 6 mcg plus budesonide 200 mcg rotacap , formoterol 6 mcg plus budesonide 400 mcg rotacap , framycetin sulphate cream bp 1 percent cream 15 or 20 gm , gabapentin 100 mg tab , gabapentin 300 mg plus methylcobalamin 500 mg tab , gabapentin 300mg tab or cap , gamma benzene hexachloride 1 percent w by v cetrimide 0 point 1 percent w by v in alcoholic solution , gatifloxacin 0 point 3percent plus prednisolone 1 percent 5 ml eye drops , gatifloxacin 0 point 3 percent eye drops bott of 5 ml , gliclazide 30 mg mr tab , gliclazide 40 mg tab , gliclazide 60 mg mr tab , gliclazide 80 mg tab , glimepiride 2mg plus metformin 500 mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glimepiride 1 mg plus metformin 500 mg tab , glimepiride 2 mg plus metformin 1000 mg sr tab , gloves operation size 7 powdered pair of , gloves operation size 6 point 5 powdered pair of , gloves operation size 7 point 5 powdered pair of , glucosamine 250mg plus chondroitin sulphate 200 mg cap or tab , glucosamine 500 mg tab , glucosamine 750 mg plus diacerin 50 mg plus methysuphonylmethanone 200 mg tab , glucosamine 750 mg plus diacerin 50 mg tab , glutathione 50 mg tab , glycerine ip bottle of 100 ml , glyceryl trinitrate 2 point 6 mg tab , gum paint 15 ml tannic acid 2 percent plus zinc chloride 1 percent plus cerimide 0 point 1 percent w by v , heel pad silicon pair of , hydralazine 37 point 5 mg plus isosorbide dinitrate 20 mg tab , hydrochlorothiazide 12 point 5 mg tab , hydrochlorothiazide 25 mg tab , hydroxychloroquine 200 mg tab , hydroxychloroquine 300 mg tab , hydroxyzine 10 mg tab , hydroxyzine 25 mg tab , ibandronic acid 150 mg tab , indapamide sr 1 point 5 mg tab , indomethacin 75 mg sr cap or tab , inh ipratropium bromide 20 mcg plus levosalbutamol 50 mcg 200 mdi , inj denosumab solution 60 mg per ml , inj etophylline 84 point 7 plus theophylline 25 point 3 per ml 2 ml inj , human insulin analogue glargine inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen 3 ml pfp , inj glulisine 100iu per ml 3 ml pfp , inj insulin isophane 70 percent plus human insulin 30 percent 100 iu per ml 3 ml pfs , inj insulin aspart 100iu per ml pen human insulin analogue rapid acting inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen , inj iron ferric carboxymaltose 500 mg 50 mg per ml 10 ml vial for inj , inj iron sucrose 100 mg per 5 ml , inj levocarnitine 500 mg , multi vit inj iv 2 to 10 ml with minimum constituents having thiamine b1 30 mg per ml pyridoxine b6 30 mg per ml and b12 cyanocobalamin 300 mcg per ml , inj pantoprazole 40 mg , inj tetanus toxoid 0.5 ml , insulin syringe disposable 40 iu , isapgol or ispaghula husk 3 point 5 gm sachet , isosorbide 5 mononitrate 30 mg tab , isosorbide dinitrate 10 mg tab , itopride 50 mg tab , itraconazole 100 mg tab , itraconazole 200 mg cap or tab , ivabradine 5 mg tab , ivermectin 6 mg tab , ketoconazole cream 2 percent tube of 30 gm , ketoconazole shampoo , ketorolac 10 mg tab , kit for estimation of alkaline phosphate , kit for estimation of bilirubin , kit for estimation of glucose , kit for estimation of hdl , kit for estimation of triglyceride , kit for estimation of uric acid , knee caps size l pair of , knee caps size m pair of , knee caps size xl pair of , knee caps size xll pair of , lactobacilllus 1 gm sachet , lancet needle , leflunomide 10 mg tab , leflunomide 20 mg tab , levitiracetam sr 500 mg tab , levocarnitine 500 mg tab , levocetrizine 5mg plus montelukast 10 mg tab , levocetrizine 5 mg tab , levosalbutamol 1 point 25 mg plus ipratropium 500 mcg in 2 point 5 ml respule , levosalbutamol 100 mcg plus beclomethasone 100 mcg rotacap , levosulpiride 25 mg tab , lignocaine 5 percent plus gabapentin 6 percent oint tube of 10 gm , lignocaine hcl jelly 2 percent tube of 30 gm with sterile tube and short

Corporations And Associations And Others

CTN :39422929

03 Apr, 2025 51.44 Crore

Panchkula - Haryana

Tender For corrigendum : online tender for the rate contract for the supply of dental items to various hospitals of government of haryana for a period of two years for group c - cotton rolls ( small, pkt of 1000 pcs), disposable patient drape sheet 1*1mm, gum paint based on tannic acid, potassium iodide, zinc chloride, glycerine with thymol/ menthol /cetrimide, liquid 15 ml bottle, hybrid composite resin for anteriors (all shades), high strength, long lasting wear resitance, great handling without stick, 4 gm isi/ iso/ce/marked., rubber dam kit adult, box of 152*152 mm, medium rubber dam sheets, 152 mm template, 152 mm plastic dental dam frame, 6-11 clamps pack with clamp holder, rubber dam clamp forcep, rubber dam punch mdr/isi/iso/ce marked, glass ionomer cement- type-ix, high strenth for posterior teeth, chemical setting without shrinkage, strontium based, high flouride releasing, 12 to 15 gm powder and 5 to 10 gm liquid, mdr/isi/iso/ce marked, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel. shade :- pale yellow, shade :- pale yellow, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- yellow brown, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- dark grey, mdr/isi/iso/ce certified /usfda, disposable suction tips pkt of 100, mineral trioxide aggregate mdr/isi/ iso/ce/marked., silver alloy non gamma-2 lathe cut alloy, 30 gm vial mdr/isi/iso/ce marked, niti hand files (21 mm) size- 15-40, for curved canals, pkt. of six mdr/isi/iso/ ce marked, pit & fissure sealant ( 6 ml bottle) solution with high flouride releasing, low viscocity, high retention, rapid cure & low solubility. mdr/isi/iso/ce marked/usfda, preadjusted edgewise stainless steel bracket kit containing upper and lower 2nd premolar to 2nd premolar bondable brackets with upper triple and lower double weldable molar tubes and mbt 0.022 prescription, fiber- reinforced splinting material- bondable reinforced ribben fiber-approx 2mm width mdr/isi/ iso/ce/marked., niti rotary files 4% 21mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be specified at the time of order), addition silicone impression material (600 ml putty with 2 cartridges of 50 ml light body), air rotor spray isi/iso/ce marked, calcium hydroxide, paste system based and catalyst -radiopaque, 4 gm mdr/isi/iso/ce marked, acidulated phosphate fluoride gel 1.25%(apf), gic luting pkt. of 30-35gm powder, flowable composite 2-4 grams, x-ray processing solution(set of developer & fixer powder, manual, to make 13.5 ltr solution), root canal spreaders pkt. of 6 #15-40 21mm, dental chair covering sterilized cling foil rolls mdr/isi/ iso/ce/marked., mta pkt. of 1gm, tooth preparation kit (set of 14 burs), root canal k files 21mm (pkt. of 6) #15-40, dental amalgam capsules pkt. of 50 capsules, impression compound, gic restorative pkt. of 10-15 gm powder, bleaching kit, diamond burs- various shapes including round, tapered round, flat fissure, pear (size and shape of burs required will be specified at the time of order)- coarse / fine grit. pkt of 5, niti rotary files 4% 25mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be spe

Central Government And Public Sector

CTN :39711374

15 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spary) 120 meter d

CTN :39724420

11 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), storage bottles,

CTN :39731204

08 Apr, 2025 NA

Gandhinagar - Gujarat

Tender For procurement of medicines - tab paracetamol 650 mg , paracetamol with cysteine hcl monohydrate infusion 1000 mg/100 ml , itraconazole 200 mg capsule , tab rosuvastatin 20 mg , tacrolimus 0.03 % tub of 20 gm ung , ung povidine iodine tube of 10 gm , syp cremaffin (liquid paraffin and milk of magnesia oral solution) , steristrip , midazolam nasal spray 0.5 mg/spray 5 ml bottle , haloperidol 5mg/ml inj , salmeterol 25mcg + fluticasone 250mcg (seroflow) , cap rejoint(glucosamine 250mg + chondroitin sulphate 200mg cap) , seratiopeptidase 5mg tab , diphtheria , and tetanus vaccine (dtap) vial of 5 ml , zoster cream (acyclovir cream) , keto diastix bott of 50 strips. , kits for estimation of cholestrol (erba) bott of 5 x 20 ml , kits for estimation of glucose (erba) bott of 5 x 60 ml , kits for estimation of urea (erba) bott of 5 x 20 ml , kits for estimation of uric acid (erba) , kits for estimation of creatinine (erba) bott of 4 x 60 ml , kits for estimation of sgot (ast) (erba) bott of 5 x 20 ml , kits for estimation of sgpt (alt) (erba) bott of 5 x 20 ml , triglyceride kit (erba) bott of 5 x 20 ml , vitamin d3 (200 iu/ml) drops , corn cap , oflox-d (ofloxacin 0.3% , dexamethasone sod.phosphate 0.1% , drabkins solution (diluting solution for haemoglobin estimation by cyanameth haemoglobin method) , ecg paper for bpl cardiart - 6208 view , band aid water proof , candid b lotion (clotrimazole+beclomethasone) , wbc fluid , scrub typhus test kit (card) , wash kit (erba) bott of 4 x 50 ml , deionised water/distilled water , t-minic syp (phenylephrine and chlorpheniramine) , mucaine gel (oxetacaine bp 10mg , aluminium hydroxide 0.291 gm , magnesium hydroxide ip 98mg) , karvol plus(menthol , chlorothymol , eucalyptol , terpinol & camphor) , clobetasole propionate , neomycin sulphate , miconazole nitrate and chlorhexidine gluconate solution cream (quadriderm) , ambrohist plus(ambroxol hydrochloride , guaiphenesin , phenylephrine hydrochloride , chloropheniramine maleate & menthol syp) bott of 100ml , dicyclomine hcl ip 20 mg+ paracetamol ip 500 mg tab , evion cream (vitamin e) , sore gel (chorine salicylate & lignocaine mouth gel) , leflunamide 10 mg tab , candibiotic ear drop (beclomethasone dipropionate , neomycin and clotrimazole) , eberconazole 1% cream , tube of 30 gm , battery for glucometer c 3v , cilnidipine 10 mg tab , colimex drops (dicyclomine and dimethicone) , cap vit e 400mg , suction catheter , tab carbamazepine 300 cr , syp tusq dx bott of 100 ml(phenylephrine , chlorpheniramine maleate and dextromethorphan hydrobromide) , dolocold(paracetamol , phenylphrine hydrochloride , chlorpheniramine and caffeine)pead nasal drop , aceclofenac 100mg + paracetamol 325mg tab , pencil cell , miconazole nitrate cream , vitasip (multivitamin drops) , feeding tube (infant) , prolene suture 2-0 pkt of 12 with cutting needle , prolene suture 3-0 pkt of 12 with cutting needle , prolene suture 5-0 pkt of 12 cutting needle , tab tamsulosin 0.4 mg + tab dutasteride 0.5 mg , migran/vasograin tab (ergotamine 1mg+caffeine 100mg+ paracetamol 250 mg+prochlorperazine 2.5 mg) , terbicad oint (terbinafine + ofloxacin +ornidazole+clobetasole)) , formalin tab , clindasil (clindamycin 1% & nicotinamide 4% gel) , ambrodil s (ambroxol hcl , salbutamaol , guaiphenesin) , gabapentin 100 mg cap , tobramycin 0.3% e/d bott of 5 ml , multi para uristicks(10 parameters) , spironolactone 50 mg tab , powergyl (ofloxacin & ornidazole suspension) , widal kit (rapid card for typhoid) , niosalic - 6 oint (clobetasol and salicylic acid oint) , tmf(mefenamic acid 250 mg and tranexamic acid 500 mg) , levosalbutamol metered dose inhaler 100mcg/dose , clocip-b ung (clotrimazole ip 1% and beclomethasone dipropionate ip 0.025%) , syp zinc 20 mg/5 ml , bottle of 100 ml , ecg gel , tab zincovit (multivitamin , multimineral with grape seed extract tab) , rabeprazole 20 mg + domperidone 30 mg sustained release tab , knee cap , neurobion forte tab (vitamin b compl

Central Government And Public Sector

CTN :39354939

25 Mar, 2025 292

Mandya - Karnataka

Tender For corrigendum : supply of tablets, capsules etc items to mims, mandya - gabapentane ---tabs, lignocaine gel 2% 30gm sterile , lignocaine 2% gel 30mg , diclofenac gel, dinoprostodine gel, gamabenzayl hexa chloride lotion 60ml, permethrin lotions, calamine lotion 8%, thrombophobe ointment, tacrolimus oint 0.03% ointment, tacrolimus oint 0.1% ointment, sertaconazole cream 15%, silver sulphadiazine 1% 250 gm jar, silver sulphadiazine 1% 15 gm oint , soframycin cream, povidine ointment, povidone iodine 125 gm ointment, povidone iodine 250gm ointment, permethrin creams, mupirocin ointment 2%, mometasone+salycillic ointment, mometasone ointment, fusidic acid ointment 2%, clobetasol + fusidic acid cream, clobetasol&salicylic acid oint 3%, clobetasol butorate ointment, ciprofloxacin oint, clotrimoxazole dusting powder, clotrimoxazole oint 15gm, clindamycin+adapalene 15gm, clindamycin phosphate 15gm ointment, benzoic acid + salycillic acid oint, xylomethazoline nasal drops, wax solvent ear drops, voriconazole 30mg lipolysed powder eye drops, tobramycin 0.3% eye drops, timolol 0.5% eye drops, tropicamide eye drops 8%+phenylepherine 5% eye drops, tropicamide 1 % eye drops , saline nasal dropss, proparacaine eye 0.5% drops , olapatadine 0.1% eye drops, ofloxacin drops 0.3% + dexamethasone 0.1%eye drops ocular use only , ofloxacin drops 0.3% eye drops ocular use only , natamycin 5% eye drops, nasal douching wash alakaline /saline, homatropine 2% eye drops, hemocogulase aqua solution, gentamycin ear drops 0.3%, fluconazole ear drops 0.3%, cyclopentolate 1% eye drops, clotrimoxazole ear drops, ciprofloxacin ear drops, ciprofloxacin 0.3 % eye drops, carboxy methylcellulose 0.5% eye drops, balanced salt solutions, balanced salt solution , salbutamol respirator solution, levosalbutamol respirator solution, levosalbutamol and ipratropium solution , budesonide respirator suspension, clotrimazole vaginal suppository , diclofenac suppository , paracetamol suppository 250mgs, paracetamol suppository 170mg, paracetamol suppository 80mgs, ors packets , hmf sachets use for neonatal use 1gm, pre-probiotic sachet, sporolac sachets, zincsulphate drops, vitamin d3 --dropss, paracetamol drops, ondensetron drops, multivitamin dropss, ferrous sulphate drops, domperidone drops, dicyclomin & dimethicone drops, caffene citrate oral drops, zincsulphate syp, terbutaline +ambroxal syrup, sildenofil syrup, salbutamol syrup, ranitidine syrup, paracetamol --syrups, paracetamol syrups, oral glycerol 3% syrup, ondansetran syrup, multivitamin syrups, magaldrate simethicone suspension, lactolose syrup, levosalbutamol +ambroxal syrup, levosalbutamol syrup, ibufrufen with paracetamol syrup, ferrous ascorbates & folic acid syrup, hydroxyzine syrup, dicyclomin & dimethicone suspension , choline and methionine & vitamin syrup, cepodoxime syrup, citrizine syp, cefexime 30ml syp, cotrimoxazole syp , chloropheniramine+paracetamol +phenylheprine syrup, calcium +phosphours +vitamin d3 syrup, albendazole syp, azithromycin syp, amoxicillin +potasium clavanate syp, amoxicillin 125mg suspension , zinc sulphate tab, vitamin-c tab, vitamin d3 tab, tranxemic acid sr tab, thiamine 100mg tabs, telmesarten with chlorthalidone tab, teneligiptin 20mg tab, tapentadol 50mg tab, telmisarten tabs, telmisarten tab, terbinafine tab, thiocholchioside tab, thaliodomide tab, tripsin + chymotrypsin tab, tramadol+paracetamol tab, tramadol ip caps , trihexyphenidyl, tamsulosilin hcl tab, solifenacin 5mg tabs, sulfasalazine tab, sodium valporate tabs, sodium valporate tab , sertraline hydrochloride tab , sildenofil tab, silodolin +dutesride tab, silodolsin tabs, silodolsin tab, salbutamol sulphate tab , spironolactone tab, resperidone tabs, resperidone tab, ramipril tab , ranitidine tab, quetiapine 50mg tab, prazosin tab, propranolol 40mg tabs, phenytoin sodium tab, phenobarbitone tabs, phenobarbitone tab , pantaprazole + levosulpride caps, pantaprazole tab, pregabalin tab, prednisolone ta

Central Government/Public Sector

CTN :39697545

04 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , triclogel dispense

Phosphatidylcholine Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Corporations And Associations And Others

Central Government And Public Sector

Central Government And Public Sector

Central Government/Public Sector