Web Analytics Made Easy - StatCounter

Photo Therapy Unit Tenders

Get complete information related to latest Photo Therapy Unit Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Photo Therapy Unit Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Photo Therapy Unit Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39299412 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For bid to ras supply of rpr test kit , crp latex slide agglutination test kit , toxo igm antibody elisa test kit , rubella igm antibody elisa test kit , cmv igm antibody elisa test kit , herpes type i igm antibody elisa test kit , herpes type ii igm antibody elisa test kit , enzyme immunoassay for detection of hbsag , hcv elisa test kit , pt kit (thrmboplastin time) , aptt kit (activated partial thromboplastin time) , pap pen ihc , poly-l-lysine ihc , anti cytokeratin(cam 5.2) (ihc formalin fixed paraffin embedding) , er (ihc formalin fixed paraffin embedding) , cyclin d1(ihc formalin fixed paraffin embedding) , pax-5(ihc formalin fixed paraffin embedding) , afp (ihc formalin fixed paraffin embedding) , ck 7 (ihc) formalin fixed paraffin embedding) , p 63 (ihc) formalin fixed paraffin embedding) , cd19(ihc formalin fixed paraffin embedding) , her-2/neu(ihc formalin fixed paraffin embedding) , cd34(ihc formalin fixed paraffin embedding) , bcl-2 (ihc formalin fixed paraffin embedding) . , calretinin (ihc formalin fixed paraffin embedding) , edta powder , glypican 3 (ihc formalin fixed paraffin embedding) , cd 117 (ihc formalin fixed paraffin embedding) , serum total cholesterol , pax 8 (ihc formalin fixed paraffin embedding) , gata 3 (ihc formalin fixed paraffin embedding) , field stain a , field stain b , csf micro protein assesment kit , d-dimer (latex agglutination based kit) , rapid pap stain kit , desmin (ihc formalin fixed paraffin embedding) , sma (ihc formalin fixed paraffin embedding) , ck20 (ihc formalin fixed paraffin embedding) , napsin a (ihc formalin fixed paraffin embedding) , podoplanin (ihc formalin fixed paraffin embedding) , cd 57(ihc formalin fixed paraffin embedding) , s 100 (ihc formalin fixed paraffin embedding) , vimentin (ihc formalin fixed paraffin embedding) , pr (ihc formalin fixed paraffin embedding) , cfra21.1 (test for cfra 21.1 by elisa method, serum/plasma, 96 well type, reactive to human, sensitivi , c-peptide(test for c-peptide by elisa method, serum/plasma, 96 well type, reactive to human) , ds dna( test for ds-dna by elisa method, serum/plasma, 98 well type, reactive to human) (code-) , ca 19.9 elisa test kit , cuvettes suitable for arx clot semi automated coagulometer , nkx 3.1 (ihc formalin fixed paraffin embedding) , cd1a (ihc formalin fixed paraffin embedding) , androgen receptor (ar) (ihc formalin fixed paraffin embedding) , gfap(ihc) formalin fixed paraffin embedding , cd 43 (ihc formalin fixed paraffin embedding) , idh-1(ihc) formalin fixed paraffin embedding , he 4(test for he 4 by elisa method, serum/plasma, 96 well type, reactive to human , cdx2 (ihc formalin fixed paraffin embedding) , ana (test for ana by elisa method, serum/plasma, 96 well type, reactive to human) , chromogranin-a (ihc formalin fixed paraffin embedding) , occult blood , measles igm elisa test kit , cea(ihc formalin fixed paraffin embedding) , u shaped 96 microtiter plate with lid , antibiotic powdervancomycin hydrochloride salt , mueller hinton broth(cation-adjusted) , brain heart infusion powder (bhi) , antibiotic powder colistin salt sulphate , tryptic soya agar , sterilization indicator-biological indicator for sterilization-b. stearothermophilus 106bspores/stri , sterilization indicatorchemical autoclave tape , distilled water , troponin-i rapid card test , acid alkaline wash for erba fully automated analyzer 360 , urea berthlot end point , cholinesterase , automated rna extraction kit qiaamp dsp pathogen mini kit

Central Government And Public Sector

CTN :39967266 Due date: 23 Apr, 202523 Apr, 2025 24
Tender For re tender for supply of vrdl consumables items.call-3 (due to technical error in eproc) - japanese encepahlitis detect igm elisa kit 96 rxns , zika igm elisa kit 96 rxns , measles igm elisa kit 96 rxns , cytomegalovirus igm elisa kit 96 rxns , varicella zoster virus igm elisa kit 96 rxns , brucella igm elisa kit 96 rxns , primescript one step rt pcr kit rr055 100rxns , superscript iii platinum taq mix 100rxns , super scripttm iii one step rt pcr system with platinum tm taq dna polimerase, 100rxns, diluent for dna extraction 500 ml , nucleotide sequencing sanger method , nulceotide probe fam labelled, nulceotide probe hex labelled, primer nucleotide bases , shoe cover dispenser, zip lock cover s, m, l size 100/paack , dengue igm elisa kit 96 rxns , charcoal activated powder 500 gm , nitrile glove l 100 piece/box , buffer 100 ml 10 x te, buffer 500 ml 50 x tae, toxoplasma igm elisa kit , rubella igm elisa kit, brucella slide agglutination kit

CTN :39926419 Due date: 26 Apr, 202526 Apr, 2025 NA
Tender For supply of rapid immunochromatography kit for typhoid fever , hbsag detection kit immunochromatography , hcv detection kit immunochromatography , hiv detection kit immunochromatography , ns1 antigen for dengue detection , dengue duo ns1 plus ab combo , hbsag elisa kit kit of 96 wells , ana elisa kit of 96 wells , rapid agglutination test for salmonella widal 4x5 ml , rapid latex agglutination ra factor test with controls , rapid latex agglutination crp test with controls , rapid latex agglutination aso test with controls , hiv elisa kit kit of 96 wells , hcv elisa kit kit of 96 wells , rapid pregnancy detection by immunochromatography , anti ccp elisa kit of 96 wells , micro tips 5 to 200 ul , filtered tips 0 point 2 to 10 microliter box of 96 , nitrile powder free hand gloves non sterile size 7 point 5 , nuclease free water for pcr , 10 x tbe buffer , dna ladder 100 bp , dna extraction kit from blood by spin column base , hla b27 kit of 96 tests , deionized water , vacutainer heparin 9 ml , phosphate buffered saline , agarose powder molecular biology grade , 15 ml falcon tube , 50 ml falcon tube , dengue igm elisa kit of 96 tests , sterile container for urine collection , dextrose monohydrate for oral use in pack of 100 gm with or without vitamins and minerals , uristix glucose plus albumin , urine multistix cards min 10 parametres compatible to siemens urine analyser , kit for stool occult blood 50 tests

CTN :39889570 Due date: 15 Apr, 202515 Apr, 2025 30.00 Lacs
Tender For supply of lab reagents and consumables - semi-automactic bio-chemistry analyzer, albumin (5x50ml), alkline phosphtase 4x24 + 4x6ml), bilirubin kit (4x60ml), cholestrol kit (5x30ml), creatinine kit (4x60m)l, ggt (5x6.5ml), glucose kit (5x60ml), hdl kit (4x30ml + 4x10ml), high control for semi auto (1x5ml), normal control for semi auto (1x5ml), sgot kit (4x24ml + 4x6ml), sgpt kit (4x24ml + 4x6ml), total protein (5x50ml), triglycerides kit (4x24ml + 4x6ml), urea kit (4x24ml + 4x6ml), uric acid kit (4x24ml + 4x6ml), wash kit (4x50ml), general lab chemicals and consumables, absolute alcohol 70% (500 ml), almunium slide tray, anti ab, anti d ( igg+ igm), anti human sera/ coombs sera, anti sera abo rh/ blood group test kit (10ml each, total 30ml), anti-d igg 10 ml, anti-d igm 10 ml, aso 50 test titer rapid method, band aid, beaker 1000ml, beaker 100ml, beaker 250ml, beaker 500ml, blood grouping plate, blotting sheet, blue tips, bovine albumin, capillary tubes, card for haemo spot, centrifuge tube stand 15 ml(10*2), centrifuge tube stand 50 ml(15*2), conical flask 500 ml, coplin jars, copper sulphate powder 500gm, covid elisa anigen kit (icmr approved), crp 50 test kit (qualitative), cryo box with lid, cryo vials 2 ml, culture swab stick, diamond marking pencils, disposable alcohol swab, disposable esr pipette, disposable esr tube (westergen method), distilled dionized water 5 ltr, distilled double dionized water 5 ltr, distilled triple dionized water 5 ltr, double blood bag 300 ml, dpx mount, durham tube, edta vial (non vacuum), edta vial (vacuum), eppen drop vial ( mct ), esr black vial (non vacuum), esr black vial (vacuum), esr stand, ethanol absolute, falcon tube, filter paper, filter tip 10 micro litre (1*960), filter tip 100 micro litre (1*960), filter tip 20 micro litre (1*960), filter tip 200 micro litre (1*960), filter tip 5 micro litre (1*960), floride vial (non vacuum), floride vial (vacuum), fouchet reagent, giemsa stain 125 ml, glacial acetic acid, glass bottel round 1000ml, glass bottel round 500ml, glass cover slip 22 mm, glass pipett 10ml, glass pipett 2ml, glass pipett 5ml, glass slide, h & e stain (haematoxillin stain), h.i.v elisa 4th generation (96 test), hand sanitizer 5 ltr (ip base), hbsag card, hbsag elisa 4th generation (96 test), hcv elisa 4th generation (96 test), hcv rapid card, hiv rapid card, hydro chloric acid 500 ml, ice gel pack, j.s.b 1 stain, j.s.b 2 stain, kalazar test rapid card, lancet (auto destroyable/safety lancet), lancet (twisted round), leucoreduction filter, lieshmen powder 25 gm, lugal iodine 125 ml, malaria antigen card, manual rna extraction kit 50 test (icmr approved), mathenol 2.5 ltrs, mct vials 1.5ml, mct vials 2.0ml, measuring cylinder 1000ml, measuring cylinder 100ml, measuring cylinder 20ml, measuring cylinder 500ml, microscope cover glass 22 x 40 mm, micropipette single channel fixed volume fully autoclavable (all size variants), micropipette single channel variable volume fully autoclavable (all size variants), micropipette 8 channel variable volume fully autoclavable (all size variants), micropipette 12 channel variable volume fully autoclavable (all size variants), multistix, n/10 hcl 500ml, naoh sodium hydroxide, og 6, oil immersion 25ml, o-toluidine (500ml), parafilm tape, pastuer pipette, ph paper 5.0 to 7.5, plain vial (non vacuum), plain vial (vacuum), potassium permagnate, ppe kit (citra & drda approved), pregnancy cards/ upt cards, qiaamp dna blood mini kit (250 test), qiaamp viral rna blood mini kit (250 test), quadraple blood bags 450ml, ra factor 50 test kits, rapid antigen detection card test for bacterial meningitis, rapid pap stain kit, rapid test card for cephalosporin, rapid test kit igg, igm, ns1 for dengue, reversible rack mct, rt-pcr flu kit (192 test), rt-pcr hbv quantative kit (192 test), rt-pcr hcv quantative kit (192 test), rtpcr kits 96 test for covid-19 (icmr approved), rubber teat for pipette, salt iodine testing kit, sample cup with label (3 s

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
 Loading, Please wait...

Connect us via What's Up