Latest potassium nitrate Tenders | Government potassium nitrate Tenders

CTN :39498893

14 Apr, 2025 NA

Pune - Maharashtra

Tender For bid to ras supply of potassium nitrate grade i 125 micron

State Government

CTN :39790096

29 Apr, 2025 NA

Guwahati - Assam

Tender For corrigendum : empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii

CTN :39947081

26 Apr, 2025 NA

Sagar - Madhya Pradesh

Tender For supply of disposable plastic infusion set for plasma blood presterilised pyrogen free complete with airl ine and nylon filter alongwith air vent , lignocaine hcl 2 percent without adrenaline 30 ml inj suitable for ophthalmic use also , lidocaine lignocaine hcl 2 percent with adrenaline epinephrine 1 80000 1.8 ml cartridge , lignocaine hcl jelly 2 percent tube of 30 gm with sterile tube and short nozzle suitable for intra urethral use, should be packed within a sterile blister pack , tab paracetamol 650 mg , paracetamol 325mg and ibuprofen 400mg tab , hydrocortisone sodium succininate 100 mg inj , enalapril 5 mg tab , desensitising paste stannous fluoride potassium nitrate sodium monofluro-phosphate tube of 40-55 ml or gm , clotrimazole pulv 1 percent bott of 75 gm , soft cervical collar , lactulose syp, each 5ml containing 3.325g bott of 100 ml , sodium chloride 0.65 percent w v nasal drops of 15 ml , xylometazoline hcl 0.05 percent w v nasal solution for paed use, bott of 10ml , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 100 ml , dental floss pack of 50 , glucosamine 500 mg tab , amoxycillin 500 mg and clavulanic acid 125 mg tab , tetanus toxoid, purified, absorbed rubber capped, vial of 0.5 ml , apparatus oxygen inhalation portable facemask disposable for , syringe dosposable plastic sterile 10 ml with needle , bandage elastic adhesive 6 cm x 3 metres unstretched and 5-6 metres when stretched. , bandage, plaster of paris 15 cm x 3 metres , anti haemorhoidal ointment containing betamethasone 0.05 percent phenylephrine 0.1percent and lignocaine 2.5percent tube of 15 gm with applicator , inj thiamime vitamin b1 100 mg per ml , ecg roll 210cm , norflox syp 100mg per 5ml bott of 30 ml , syp mefenamic acid 100mg and paracetamol 250mg bott of 60 ml , rifampicin 600 mg tab , clofazimine 300 mg cap , dapsone 100 mg tab , clobetasole propionate cream 0.05 percent in tube of 10 gm , l-methylfolate calcium 1000mcg and methylcobalamin 1500mg and pridoxal 5 phosphate 500mcg and docosahexaenoic acid 200mg , pregabalin 75 mg and methylcobalamine 1500 mcg tab , tab rosuvastatin 10 mg and fenofibrate 160 mg , tab telmisartan 40 and chlorthalidone 6.25 mg , tab thyroxine 62.5 mcg , linagliptin 5 mg tab , enoxaparin 40 mg per 0.4ml inj , calcium citrate malate 250mg and vitamin d3 100 iu and folic acid 50 mcg , tab metformin sr 0.5 gm , paracetamol syp 125 mg per 5 ml bottle of 60 ml , pantoprazole 40mg tab bid details/ 2 / 35

CTN :39920687

14 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of various chemicals - labchem acetic acid glacial ch3cooh , labchem acetone c3h6o , labchem ammonium acetate c2h7no2 , labchem ammonium chloride , labchem ammonium ferrous sulphate , labchem ammonium hydroxide nh4oh , labchem ammonium molybdate nh4 6mo7o , labchem boric acid h3bo3 , labchem edta c10h16n2o8 , labchem hydrochloric acid hcl , labchem hydrofluoric acid , labchem hydrogen peroxide , labchem bromocresol purple i c21h16br2o , labchem ebt indicator , labchem methyl orange indica c14h14n3na , labchem copper pan indicator c15h11n30 , labchem pr indicator c21h14n2o7 , labchem xylenol orange indic c31h32n2o1 , labchem sdps indicator , labchem iso propyl alcohol , labchem labolene cleaning r , labchem mercuric chloride , labchem methanol ch3oh , labchem orthophosphoric acid h3po4 , labchem oxalic acid c2h2o4 , labchem ph buffer tablets ph 4.00 , labchem ph buffer tablets ph 7.00 , labchem ph buffer tablets ph 9.20 , labchem potassium hydroxide koh , labchem quinoline , labchem silicon grease lubricant , labchem silver nitrate agno3 , labchem sodium bi carbonate nahco3 , labchem sodium meta bisulphite na2s2o5 , labchem sodium potassium tartrate , labchem sodium sulphate anhyhrous , labchem stannous chloride sncl2 , labchem stearic acid , labchem sulphuric acid h2so4 , labchem zinc acetate zn ch3co2 2 , labchem zinc oxide , labchem benzene , labchem glycerol 2.5 l ex , labchem methyl red indicator , labchem perchloric acid , labchem sodium nitrate , labchem sodium peroxide granular , labchem tin metal , labchem ammonium oxalate nh4 2c2o4 , labchem ammonium persulphate , labchem ammonium thiocyanate , labchem citric acid c6h8o7 , labchem dimethyl glyoxime c4h8n2o2 , labchem ethanol , chemical anhydrous ferric chloride fecl3 , labchem hydroxylamine hydrochloride , nisp project material bromocresol green , labchem potassium ferricyani k fe cn , labchem sodium bisulphite , labchem sodium fluoride anhydrous , labchem zinc sulphate hepta znso47h2o , labchem benzoin oxime , chromium oxide iii green 500 gm pack , carnauba wax , carborandum powder mesh 400 , carborandum powder mesh 800 , carborandum powder mesh 1000 , carborandum powder mesh 1200 , conductivity standard 12.88us cm , conductivity standard 1413us cm

CTN :39530511

15 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various chemicals and fine chemicals, at skims, soura, srinagar on one year rate contract basis. - item specifications, 2-mercaptoethanol, absolute alcohol 99%, acetic acid, acetic acid glacial, acetone, acid fuchsin, acrylamide, alpha naphthol, alpha naphthylamine, ammonium acetate, ammonium chloride, ammonium persulphate, amyl alcohol, basic fuchsin, bis-acrylamide, bismark brown (powder), boric acid, bromophenol blue, calcium chloride, calcofluor white, carbol fuchsin (zn, strong), chloroform, conc. hydrochloric acid (hcl), conductive electrode paste/eeg paste, copper sulphate, crystal violet, diethyl pyrocarbonate (depc), dimethyl formamide, dimethyl sulfoxide (dmso), dimethyl-p-phenylene diamine dihydrogen chloride, dipotassium hydrogen phosphate, disodium edta, disodium hydrogen phosphate, dpc, dpx, edta dipotassium salt, eosin liquid, eosin powder, eosin y, ethanol 99%, ethedium bromide (etbr), ethyl alcohol, formaldehyde 37%, formic acid 85%, fungizone, giemsa stain, glycerol glycerin 98%, haematoxylin harris, hematoxylin (liquid), hematoxylin (powder), hydrochloric acid (98%), hydrogen peroxide (30%), hypochlorite solution (4%), iodine, isoamyl alcohol, isopropyl alcohol 99%, l pyrrolidonyl-b-naphthylamide, laboratory detergent, leishman s stain, liquid ammonia, lithium powder, magnesium chloride, magnesium citrate, magnesium sulphate, may grunwald stain (powder), mercuric oxide powder, methanol 99%, methyl red (powdered), methylated spirit, methylene blue (powdered), medical grade soda lime with following specifications: 1. should have high absorption capacity for carbon dioxide (more than 100 ltr/kg)2. should have low dust level.3. granule size 2.5-5.0 mm4. indicator pink to white., n acetyl l cysteine, n,n, dimethyl formamide, nigrosin, nitric acid 72%, para dimethyl amino benzaldehyde, para-dimethyl amino cinnamaldehyde, parafin oil (liquid), periodic acid, phenol, phenol (tris saturated), phosphate buffer saline capsules/tablets, potassium acetate, potassium bicarbonate, potassium chloride, potassium dichromate, potassium dihydrogen orthophosphllate, potassium dihydrogen phosphate na2hpo4, potassium ferro cyanide k4fe(cn), potassium hydroxide, potassium iodide, potassium permanganate, silver nitrate, skin preparation gel, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium deoxycholate, sodium dihydrogen orthophosphate, sodium dihydrogen phosphate, sodium dodecyl sulphate (sds), sodium hippurate, sodium hydroxide, sodium hypochlorite, sodium taurocholate, sucrose, sulfanilic acid, sulphuric acid, tetramethyl-p-phenylene diamine dihydrogen chloride, toluidine blue (powder), tris, tris hcl, urea (nh3conh2), xylene 98%

CTN :39881270

21 Apr, 2025 37.84 Lacs

Darjeeling - West Bengal

Tender For supply of drugs and pharamceutical products - e ifa re 03 collagen peptide 40mg sod hyluru 30mg chondrotin tab , e ifa re 03 colostomy bag with flange and clip size 60mm with deodorant charcol chamber , e ifa re 03 colostomy bag with flenge 50mm , e ifa re 03 cough lozenges , e ifa re 03 cream fluocinolone acetonide 20 gm tube , e ifa re 03 creatinine test , e ifa re 03 liquid paraffin 1 dot 25mg magnesium hydroxide 3 dot 75mg sodium picosulphate 3 dot 3mg 170ml syp , e ifa re 03 crp kit span , e ifa re 03 cudcee forte tab prebiotic and probiotic capsules , e ifa re 03 cyclophosphomide 50 mg tab , e ifa re 03 cyclosporin 50 mg tab , e ifa re 03 cyproheptadine 4 mg tab , e ifa re 03 daflon 500mg diosmin 450mg hesperidin 50mg tab , e ifa re 03 danazole 200mg tab , e ifa re 03 dapagliflozin 10 mg metformin 500 mg tab , e ifa re 03 dapagliflozin 5 linagliptin 10 mg tab , e ifa re 03 darifenacin 7 dot 5 mg tab , e ifa re 03 deca peptide lotion , e ifa re 03 deflazacort 30mg tab , e ifa re 03 delivery system for salmeterol fluticasone rotacaps with pin puncture , e ifa re 03 dengue test igg and igm , e ifa re 03 dental gel , e ifa re 03 desensitising paste stannous fluoride potassium nitrate sod monofluorophosphate tube of 50gm , e ifa re 03 desidustat 50mg tab , e ifa re 03 desvenlafaxine 50 mg tab , e ifa re 03 chloroxylenol sol pot hydroxide 13 dot 6g chloroxylenol solution 50 dot 5g oleic acid 7 dot 5ml castor oil 63 dot 0g terpineal 100ml ethanol 96 100 ml dettol 100 ml bottle , e ifa re 03 chloroxylenol sol pot hydroxide 13 dot 6g chloroxylenol solution 50 dot 5g oleic acid 7 dot 5ml castor oil 63 dot 0g terpineal 500ml ethanol 96 100 ml dettol 500 ml bottle , e ifa re 03 dexamethasone 0 dot 5mg tab , e ifa re 03 diacerein 50 mg tab , e ifa re 03 diclofenac paracetamol serratiopeptidase tab , e ifa re 03 diclofenac 100 mg metaxalone 400 mg tab , e ifa re 03 diclofenac 50 mg serratiopeptidase 10 mg tab , e ifa re 03 diclofenac spray bottle of 40 gm , e ifa re 03 dicyclomin 10 mg tab , e ifa re 03 dicyclomine drops of 15 ml syp , e ifa re 03 dienogest 2mg , e ifa re 03 diethylcarbamazine 50 mg tab , e ifa re 03 diltiazem 60 mg tab , e ifa re 03 dimethyl fumarate 240 mg tacfidera cap , e ifa re 03 diosmin hesperidin 1000 daflon tab , e ifa re 03 disodium hydrogen citrate syrup , e ifa re 03 disposable diagnostic cartridge eg7 box of 25 , e ifa re 03 disposable insulin pen needles 4mm , e ifa re 03 distilled water , e ifa re 03 disulfiram 250 mg tab , e ifa re 03 divalproex 250 mg tab , e ifa re 03 divalproex 500 mg tab , e ifa re 03 divalproex sodium cr 500 mg tab , e ifa re 03 dns fluid bid details/ 2 / 46

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39813822

15 Apr, 2025 NA

Bhandara - Maharashtra

Tender For supply of potassium nitrate gr. i

Potassium Nitrate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

Central Government/Public Sector