Web Analytics Made Easy - StatCounter

Potassium Salt Tenders

Get complete information related to latest Potassium Salt Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Potassium Salt Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Potassium Salt Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

State Government

CTN :42409964 Due date: 06 Nov, 202506 Nov, 2025 NA
Tender For supply of carbon disulide,tin ii ethylhexanoate,pyrogallol,glutaric acid,aluminium chloride,thiourea sd,dimethylamino pyridine,zinc sterate,zinc nitrate hexahydrate,o vanillin,bis pinacolato diboron,bisdiphenylphosphino ferrocene,benzenedimethanol,adamantanedicarboxylic acid,lithium bis trifluoromethanesulfonyl imi,diglycolic acid,zinc iodide,benzyl alcohal,nitrobenzoic acid,benzenedimethanol,bromobutanoyl,ethyl acetate sa,dmso,diethyl ether,magnisium sulphate,sodium sulfate,thf,aq ammonium,isopropyl alcohol,potassium aceterate,eugenol,selenium powder,cesium carbonate,nitric acid,sulphuric acid,thionyl chloride,silicon oil,hydrogen peroxide,sodium chloride,sodium hydroxide,hexane,acetonitrile,ethanol,methanol,dichloromthane,aluminium chloride

Central Government/Public Sector

CTN :42031022 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For corrigendum : supply of himedia chemicals and consumables - 2 4 d , hygromycin b , rifampicin , kanamycin sulphate , acetosyringone , chloramphenicol , 6 bap , ms media , cefotaxime sodium salt , tryptone mb grade casitose mb grade , potassium acetate mb grade , sodium chloride mb grade , inositol , ampicillin sodium salt , murashige and skoog media , mgso4 7h2o , kh2po4 , cacl2 2h2o , ki , boric acid , niacin nicotinic acid , sucrose , phyta jar round container , phyta jar square container , picloram , mnso4 h2o , cobaltchloride hexahydrate , copper sulphate penta hydrate , edta disodium salt dihydrate , ferous sulphate hepta hydrate , sodium molybdate dihydrate , zinc sulphate hepta hydrate , thiamine hydrochloride , glycine , pyridoxin hcl , naa , streptomycin sulphate , tetracycline hydrochloride , mercuric chloride , petri plates , phyta wrap , stainless steel foeceps blunt 6inch , stainless steel foeceps blunt 8inch , stainless steel foeceps pointed 6inch , stainless steel foeceps pointed8inch , stainless steel foeceps pointed 10inch , potassium permanganate , stainless steel stand , stainless steel scalpel holder , steril scalpel blade , sterial scalpel blade , tween 20 , spermidine , centrifuge tubes 15ml , centrifuge tubes 50ml , test tube stand , stand for centrifuge tubes , wash bottles , metal loop ch2 , metal loop-ss 4 , autoclavable l spreader , disposable l speader , spatula , bluple nitrile examinatin gloves large size , bluple nitrile examinatin gloves medium size , magnetic stirres bar , magnetic stirres , magnetic rotors egg shape bar , parafilm m250 , parafilm m125 , non absorbent cottan wool , autoclavable aluminium foil , sodium hydroxide pellet , xgal , iptg , sds ultra pure , kinetin , fogger jet , hydrogen peroxide , peroxide silver , hi clean liquid soap , hi spark alkaline cleaning solution , indole 3 acetic acid iaa , agar powder , muarshigae and skoog medium , schenk and hildebrandt medium , woody plant medium , mercuric chloride , potassium permanganate , silver nitrate , sodium hypochlorite , potato dextrose agar granulated , potato dextrose broth granulted , nutreint broth , nutrient agar , acridine orange hi cert , sodium nitrate , sterile scalpel blade no 22 , mrs agar modified , acetobacter agar glucose , plate count agar , rose bengal chloramphenicol agar , aspergillus differentiation medium base , yeast extract agar , polymyxin b sulfate , bacitacin , chloramphenicol , penicillin , cycloheximide , streptomycin sulphate , crystal violet , dileunt for dna extraction , isoamyl alcohol , 2 propanol , murashige and skoog medium , hipura r dh5a competent cells , bap , yep broth , yep media , acetosyringone , cephotaxime solution , dimethyl sulphoxide dmso sterile , syringrame ndriven filters , luria bertani agar miller miller luria bertani agar , luria bertani broth miller miller luria bertani broth , phytawraptm , 1m iptg , x-gal solution 20mg ml , ethidium bromide solution 10mg ml , hifibloetm nitrocellulose membrane for blotting , amoxycillin clavulanic acid potassium salt 5 1 augmentin , 6 benzyladenine , carbenicillin disodium salt , a napthaleneacetic acid , hygromycin b , inoculation loop metaloop ch 2 , phyta wrap cling film , slides staining jar coplin type , holder stand , stainless steel forceps pointed , sterile disposable petriplates 90x25 mm , sodium hydroxide pellets , boric acid , potassium acetate , sodium chloride , tris free base , acetic acid glacial hi arr , tris hydrochloride , diluent for dna extraction , chloroform //bid details 2 / 118

CTN :42334710 Due date: 31 Oct, 202531 Oct, 2025 NA
Tender For tender for supply of laboratory chemcials : - calcium carbonate ar, hydrochloric acid. grade: ar/gr (pack.2.5 l, pottassium bromide ar, sodium molybdate ar, sulphuric acid.grade: ar/gr/er, cyanide standard solution, traceable to srm from nist., cyanide concentration: 1000mg/litre, salicylic acid lr, pyrogallol. grade: lr., ph buffer capsules (ph 4.0±0.05) pack containing, ph buffer capsules (ph 9.2±0.05) pack containing, ammonium acetate, grade: ar/gr, ammonium chloride, grade: ar/gr, ammonium fluoride ar/gr, ammonium molybdate-ar, boric acid, grade: ar/er/gr, ph paper, 2 to 10.5, 10 books in a packet, book containing 20 leaf each with colour chart in every book, ph buffer capsules (ph 7.0±0.05) pack containing, phenolphthalein indicator powder, grade lr, in containers of 50g, paraffin liquid.grade: ar/gr, phosphorous pentoxide.grade: ar/er/gr, sodium bicarbonate.grade: ar/gr, sodium hypochlorite containing 5-6% available chlorine, cadmium acetate dihydrate ar, minimum assay 9, ammonium hydroxide<(>,<)>, concentration: 25%, sp.gravity: 0.91, max limits of impurities: 0.01% non, volatile matter.chloride as, cl, :0.001% sulphate as so4: 0.002% arsenic as, as: 0.00002% iron as fe, :0.0001% lead as pb: 0.0001%, charcoal-activated, mono ammonium phosphate (map) 12:61:0, (100% water soluble), fertiliser grade conforming to fco.

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42251244 Due date: 03 Nov, 202503 Nov, 2025 NA
Tender For supply of chemicals and consumables d d - l_methionine , phosphate buffer , edta , h2_o2 , borate buffer , l_phenylalanine , tri chloro acetic acid , hydrochloric acid , 2_ mercaptoethanol , 1m sodium buffer phosphate , pyrogallol , nitro_blue tetrazolium nbt chloride , pvp , riboflavin , guaiacol , triton x , tris hcl buffer , potato dextrose agar , nutrient agar , di sodium hydrogen phosphate , sodium di hydrogen phosphate , potassium hydroxide , sodium hypochlorite , lactophenol cotton blue , maxima sybr green_rox qpcr master mix 2x , revert aid first strand cdna synthesis kit , oat meal agar , streptomycin , permanent marker black , permanent marker red , micro tube racks 20 x 2ml , bluple nitrile examination gloves , non absorbent cotton wool , absorbent cotton wool , parafilm m125 , sterile disposable petri plates , disposable face masks , spatula 200 , wash bottle capacity 500ml , metaloop ch3 , thump press dispensing dropper , straight wire nichrome ) /bid number : gem/2025/b/6780307 * /dated: 11-10-2025 & & / bid document 1 / 32

Central Government/Public Sector

CTN :42149153 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For tender for supply of boq bid for chemical items d d - potassium phosphate monobasic solution 1l , potassium phosphate dibasic solution 1l , pyrogallol 10g , laminarin from laminaria digitata 500mg , chitin azure 100mg , pvdf membrane filter , 0.22 um pore size-durapore , filter diam. 25 mm , hydrophilic 2 pack , curcumin 500mg , bisdemethoxycurcumin 5mg , demethoxycurcumin 5mg , hexadecyltrimethylammonium bromide 100g , canada balsam 25ml , potassium nitrate 500g , potassium sulfate 500g , calcium chloride dihydrate 500g , magnesium sulfate heptahydrate 250g , manganese(ii) chloride tetrahydrate 500g , ammonium molybdate tetrahydrate 100g , zinc sulfate heptahydrate 500g , copper(ii) sulfate pentahydrate 500g , iron(ii) sulfate heptahydrate 500g , calcium nitrate tetrahydrate 500g , ammonium sulfate 500g , sodium molybdate dihydrate 500g , boric acid 500g , manganese sulphate monohydrate 500g , ammonium dihydrogen phosphate 500g , edta , disodium salt , dihydrate 100gm , o-phenanthroline 500mg , acetone 500ml , acetonitrile , hplc 500ml , methanol 500ml , formic acid hydrazide 25g , water , hplc 1l , hydrochloric acid abt.35% pure 500ml , acetic acid glacial , 1000ml , iodine resublimed 100g , sodium carbonate anhydrous , hi-ar 100g , folin and ciocalteus phenol reagent , 100ml , sodium nitrite , hi-lr 500g , sodium hydroxide pellets 500g , l-ascorbic acid 25g , citric acid anhydrous 500g , ethyl acetate , hi-lr 2.5l , ethyl acetate , hplc 1l , petroleum ether 40 - 60 c , hi-lr 500ml , gallic acid monohydrate 500g , potassium chloride 250g , curcumin 5g , 2 , 2-diphenyl-1-picrylhydrazyl 1g , sodium sulphate anhydrous 1kg , 3 , 5-dinitrobenzoic acid , hi-ar 100g , haematoxylin (mayer) 500 ml , di-sodium hydrogen phosphate anhydrous 500g , sodium dihydrogen phosphate monohydrate 500g , sodium potassium tartrate tetrahydrate 500g , potassium iodide 100g , phenol , crystals 100g , sodium acetate anhydrous 100g , bradford reagent 100ml , d-phenylalanine 5g , corn meal dextrose agar 500ml , cycloheximide 5g , streptomycin 1pk , sterile mineral oil 500ml , czapek dox agar , modified , granulated 500g , methyl red indicator 125ml , bromothymol blue indicator 125ml , potato carrot agar 500g , v8 juice agar 500g , 2 , 3 , 5 - triphenyltetrazolium chloride 25g , kings medium b base , granulated 500g , oat meal agar 500g , hiindicator ph paper 1pk , parafilmd m250x 5no , coverslip 200no , triangular s. s. spreader with bakelite hand 10no , sterile , disposable l-spreader 50no , potassium permanganate-500g 500g , potato dextrose agar w/ chloramphenicol 500g , potato dextrose broth , granulated 500gm 500g , standard nutrient agar 500gm 500g , nutrient broth 500gm 500g , glycerol- 500 ml 500ml , sodium hypochlorite 4% 500ml (100mlx5) 500ml , chloroform 500ml 500ml , gram staining kit 2kit 1kg , copper (ii) acetate monohydrate 500g 500g , acetic acid , glacial 1000ml 1000ml , agar powder , bacteriological grade 500g 500g , sucrose 500gm 500g , d-glucose 1kg 1kg , peptone type i , bacteriological 500gm 500g , beef extract 500gm 500g , yeast extract powder , type i 500gm 500g , sodium chloride 500gm 500g , lactophenol cotton blue 500ml 500ml , agarose 1000g 1kg , fixative (buffered formalin fixative) for fixing cytological or histological samples 500ml 500ml , casamino acid (caesin acid hydrolysate) 500gm 500g , microscope immersion oil (125ml) -125g , gibberellic acid 100 gm 100g , copper (ii) sulphate anhydrous 500g 500g , d-glucose anhydrous 100g 100g , trichoderma harzianum selective agar base for selective isolation of trichoderma harzianum. 500g , chloramphenicol 3kt 3kt , rose bengal agar base , granulated 500g 500g , non absorbing cotton rolls (pack of 5) 5no , stainless steel scalpel holder no. 3 (pack of 2) 2no , sterile scalpel blade no. 10 (100 number) 100no , nichrome loop-d-4 diameter 4 mm , double wound , calibrated to 0.01ml.(5 number) 5no , metaloop ch-3x changeable nichrome loop embedded in brass rod with heat resistant handle

Central Government/Public Sector

CTN :42097865 Due date: 23 Oct, 202523 Oct, 2025 NA
Tender For tender for supply of chemical for laboratory : : - ammonium molybdate , potassium sulphate , sodium hydroxide pellets , barium chloride , ferric chloride , pyrogallol , soda-lime (granulares) , iodine pentaoxide , potassium hydroxide pellets , p-dimethyl amino benzaldehyde , phenolphthalein indicator , urease active meal , silver nitrate , silver sulphate , potassium sodium tartrate , potassium iodide , sodium thiosulphate , tryptone , alkali blue 6-b indicator , boric acid , ferric citrate , zinc dust , cupric sulphate
 Loading, Please wait...

Connect us via What's Up