Get complete information related to latest Propanol Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Propanol Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Propanol Tenders.
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
Tender For supply of paracetamol with cysteine hcl monohydrate infusion 1000mg 100ml , paracetamol 10 mg ml infusion in 100 ml bottle , 2 propanol 45 gm 1 propanol 30 gm ethyl hexadecyl dimethyl ammonium , hydrogen peroxide solution with snoilizer ip 20 volume 500 ml bott , levonorgestrel 0dot25 mg plus ethinylestradiol 0dot03mg pack of 21 no , hand gloves size 6 1 2 pair of , hand gloves size 7 pair of , hand gloves size 7 1 2 pair of , adhesive plaster zinc oxide 2dot5 cm x 1 mtr , adhesive plaster zinc oxide 7dot5 cm x 5 mtr , adhesive plaster micro porous tape 2 inches box of 6 , adhesive plaster micro porous tape 3 inches box of 4 , bandage crepe 10 cm , bandage crepe 15 cm , bandage elastic adhesive 6 cm x 3 metres unstretched and 5 6 , cotton wool absorbent pkt of 50 gm , cotton wool absorbent pkt of 500 gm , cotton wool non absorbent pkt of 500 gm , dressing medicated gauze paraffin 10 cm x 10 cm tin of 24 , dressing sterile 8 x 8 box of 3 , gauze surgical open woven unmedicated 60 cm wide , gauze surgical open woven unmedicated 60 cm x 3 metres packet , monofilament polyglyconate synthetic absorbable suture size 3 0 70 75 cm 1 2 , semi auto analyser wash solution for , drabkin solution diluting solution for haemoglobin estimation ny , keto diastix bott of 50 strips , strips albumin and glucose bott of 100 strips , antiseptic solution bott of 500 ml savlon , glucose solution 5percent in non toxic disposable plastic bott of 500ml ffs d5 , glucose saline isotonic solution self collapsible container dextrose 5percent , sodium chloride solution isotonic sin non toxic disposable plastic bott 500 ml , ecg roll chemical coated size 215mmx20mtr , accuchek glucometer strips bott of 50 strips , anti microbial hand wash , diclofenac diethylamine bp2dot32percent methyl salicylate i p , ecg paper roll 215mm x 20 mts , normal saline 100 ml , protein powder diabeties care 400 gm , spirit 400 ml , stocking half size large , glyseb soap , phenol soution 500 ml , chlorhexidine solution dettol 5 lit , d 5 iv 500 ml , ns iv 500 ml , roller bandage 10 cm , roller bandage 6 cm , adhesive plaster micro porous tape 1 inch box of 12 , sterile adhesive dressing 10 x 8 cm pkt , baid aid , gauze sterile , bandage abdominal binder with perineal support medium , catherer foleys silicon 2 way 5 ml size 16 fg , syringe disposable plastic sterile 2 ml with needle , syringe disposable plastic sterile 5 ml with needle , syringe dosposable plastic sterile 10 ml with needle , insulin disposable syringe 100 iu 1 ml , vaccum blood collection tubes without needles edta 3 ml , vaccum blood collection tubes without needles sterile tube with , vaccum blood collection tubes without needles sterile tube without gel 5ml , vaccum blood collection tubes without needles sodium citrate 3ml , vaccum blood collection tubes without needles and additives , arm sling pouch l , arm sling pouch m , arm sling pouch paediatric , knee cap elastic medium , knee cap elastic small , elastoplast , neoprene anklet size s m l xl , heel cushion , ls belt large , walking stick monopod , abdominal binder 10 , bandage open woven compressed 2dot5 cm x 4 metres , bandage open woven uncompressed 6 cm x 4 metres , bandage open woven uncompressed 10 cm x 4 metres , bandage triangular , bandage abdominal binder with perineal support large , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , dressing medicated adhesive 2dot5 cm x 6 cm in a single strip pack baind aid , gauze absorbent folded 2dot5 cm x 100 metres , surgeons mask disposable , n95 face mask , cannula iv with injection port and wings size 20g , cannula iv with injection port and wings size 22g , cannula iv with injection port and wings size 24g , microtips 200ul filter barrier and sterile , microtips 1000ul filter barrier and sterile , sodium chloride solution 0dot9percent non toxic plastic bottle of 100 ml , lancet disposable pre sterilised s10 , scalp vein set with luer fitting of disposable plastic siz
Tender For tender for supply of sodium hypochloride 5 percent , chlorhexidine gluconate sol equivt to 4 perc w by v with isopropanol smaller than 10 perc ethoxylate alkylphenol smaller than 10 perc fatty acid diethanolamide smaller than 10 perc acid glacial , 60 perc v by v ethyl alcohol with benzaconium chloride glycer dimethicon cyclopenta c 12 to 15 alkyl methylparaben phenoxythanol stearyl alcohol aminomethyl propanol diazolidinyl urea , 0 point 5 percent w by v chlorhexidine gluconate in 70 percent v by v ethyl alcohol with moisturizer 500 ml bott with dispenser , 1 percent w by v available iodine in non oxynoi iodine surfactant base 500 ml bott , 10 percent povidone iodine sol usp equivqlent to 1 percent available iodine 500 ml bott , alcohol free 2 percentsaturated chlorhexidine gluconate clothin a non alkaline base 15 to 20 cm in to 15 to 20 cm size , chlorhexidine sol containing chlorhexidine gluconate bp 7 point 5 percent v by v cetrimide bp 15 percent w by v 500 ml bott