Web Analytics Made Easy - StatCounter

Pyrogallol Tenders

Get complete information related to latest Pyrogallol Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Pyrogallol Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Pyrogallol Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

State Government

CTN :42409964 Due date: 06 Nov, 202506 Nov, 2025 NA
Tender For supply of carbon disulide,tin ii ethylhexanoate,pyrogallol,glutaric acid,aluminium chloride,thiourea sd,dimethylamino pyridine,zinc sterate,zinc nitrate hexahydrate,o vanillin,bis pinacolato diboron,bisdiphenylphosphino ferrocene,benzenedimethanol,adamantanedicarboxylic acid,lithium bis trifluoromethanesulfonyl imi,diglycolic acid,zinc iodide,benzyl alcohal,nitrobenzoic acid,benzenedimethanol,bromobutanoyl,ethyl acetate sa,dmso,diethyl ether,magnisium sulphate,sodium sulfate,thf,aq ammonium,isopropyl alcohol,potassium aceterate,eugenol,selenium powder,cesium carbonate,nitric acid,sulphuric acid,thionyl chloride,silicon oil,hydrogen peroxide,sodium chloride,sodium hydroxide,hexane,acetonitrile,ethanol,methanol,dichloromthane,aluminium chloride

Central Government/Public Sector

CTN :41843682 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For corrigendum : supply of library textbooks e e - bioprocess engineering basic concepts , bioprocess engineering principles , biochemical engineering fundamentals , principles of fermentation technology , bioseparation downstream processing for biotechnology , bioseparations science and engineering , pharmaceutical biotechnology concepts and applications , molecular cell biology , lewins genes xii , lehninger principles of biochemistry , kuby immunology , lippincott illustrated reviews cell and molecular biology , lippincott illustrated reviews biochemistry , the cell a molecular approach , molecular cell biology , prescotts microbiology , lippincott illustrated reviews microbiology , principles of gene manipulation and genomics , biomedical informatics computer applications in health care and biomedicine , practical mathematics for ai and deep learning a concise yet in depth guide , engineering drawing , industrial automation hands on , manufacturing engineering handbook , textbook of pathophysiology , dipiros pharmacotherapy a pathophysiologic approach , textbook of receptor pharmacology , roitts essential immunology , practical immunology , small animal imaging basics and practical guide , goodman and gilmans the pharmacological basis of therapeutics , ewings analytical instrumentation handbook , mutagenic impurities strategies for identification and control , practical hplc method development , accelerated predictive stability aps fundamentals and pharmaceutical industry practices , comprehensive chemometrics chemical and biochemical data analysis all volumes , processing metabolomics and proteomics data with open software a practical guide issn , a practical guide to metabolomics applications in health and disease , mass spectrometry in food and environmental chemistry , wilson and gisvolds textbook of organic medicinal and pharmaceutical chemistry latest edition , handbook of pharmacokinetics and toxicokinetics , reference materials in analytical chemistry a guide for selection and use , a practical handbook of preparative hplc , extraction and purification of bioactive compounds , phytochemical genomics plant metabolomics and medicinal plant genomics , isolation, identification and characterization of allelochemicals or natural products , plant secondary metabolites isolation, characterization and biological properties , marine niche applications in pharmaceutical sciences , marine specialized secondary metabolites and their diverse applications , basic pharmacokinetics , ross and wilson anatomy and physiology in health and illness , principles of research methodology and ethics in pharmaceutical sciences an application guide for students and researchers , the art and science of physiologically based pharmacokinetics modeling , advances in phytonanotechnology for treatment of various diseases , desk book of pharmaceutical dissolution science and applications , nano physical pharmaceutics , artificial intelligence in pharmaceutical sciences , freez drying or lyophilization of pharmaceutical and biological products , pharmaceutical process validation an international , melt extrusion, materials, technology and drug product design , essentials of pharmaceutical preformulation , pharmaceutical amorphous solid dispersions , exploring computational pharmaceutics ai and modeling in pharma 4.0 , morrison and boyd organic chemistry , atkins physical chemistry //bid details 2 / 41

Central Government And Public Sector

CTN :42181346 Due date: 22 Oct, 202522 Oct, 2025 15.00 Lacs
Tender For bid to ras providing of selection of laboratories for testing of products/material - drinking water; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; sample; chemical

CTN :42283706 Due date: 24 Oct, 202524 Oct, 2025 NA
Tender For supply of fire extinguisher 9 kg dcp , fire extinguisher co2 , fire extinguisher dcp 75 kg , fire extinguisher dcp 25 kg , wind sock with stand- supplying and fixing , fire proximity suit - oem make , water gel blanket , foldable stretcher , scba set with cylinder , oil spill dispersant , non-sparking tools kit , oil splash proof goggles , ss foam generator nozzle , hand operated siren 500 m range with stand , fire jet nozzles 63 mm , safety eye-wash assembly with foot paddle , emergency safety shower , pvc safety suit , high pressure fire fighting hose , flame proof search light , cold low temperature hand gloves , electrical rubber hand gloves , electrical tester , manual rescuciator , first aid box , fireman axe , megaphone explosion proof , emergency escape sets , petroleum product cleanup chemical , leak control kit , ifr suits , safety shoes , explosivemeter

CTN :42334710 Due date: 31 Oct, 202531 Oct, 2025 NA
Tender For tender for supply of laboratory chemcials : - calcium carbonate ar, hydrochloric acid. grade: ar/gr (pack.2.5 l, pottassium bromide ar, sodium molybdate ar, sulphuric acid.grade: ar/gr/er, cyanide standard solution, traceable to srm from nist., cyanide concentration: 1000mg/litre, salicylic acid lr, pyrogallol. grade: lr., ph buffer capsules (ph 4.0±0.05) pack containing, ph buffer capsules (ph 9.2±0.05) pack containing, ammonium acetate, grade: ar/gr, ammonium chloride, grade: ar/gr, ammonium fluoride ar/gr, ammonium molybdate-ar, boric acid, grade: ar/er/gr, ph paper, 2 to 10.5, 10 books in a packet, book containing 20 leaf each with colour chart in every book, ph buffer capsules (ph 7.0±0.05) pack containing, phenolphthalein indicator powder, grade lr, in containers of 50g, paraffin liquid.grade: ar/gr, phosphorous pentoxide.grade: ar/er/gr, sodium bicarbonate.grade: ar/gr, sodium hypochlorite containing 5-6% available chlorine, cadmium acetate dihydrate ar, minimum assay 9, ammonium hydroxide<(>,<)>, concentration: 25%, sp.gravity: 0.91, max limits of impurities: 0.01% non, volatile matter.chloride as, cl, :0.001% sulphate as so4: 0.002% arsenic as, as: 0.00002% iron as fe, :0.0001% lead as pb: 0.0001%, charcoal-activated, mono ammonium phosphate (map) 12:61:0, (100% water soluble), fertiliser grade conforming to fco.

CTN :42289299 Due date: 28 Oct, 202528 Oct, 2025 40
Tender For procurement of cleaning materials for bannerughatta gp for the year 2025-26 - coco broom with 5 feet length only natural product to sweep the outdoor only, garbage cover small size, metal type big web stick16 to 24 feet length, small web stick 8 feet, metal dust pan, plastic dust pan, water jug normal size, plastic bucket, system herbicide glyphosate 41% sl, ammonium salt of glyphosate 71 % sg powder, grass cutter or weed cutter 4 stroke engine honda or other brand made company only 1 year motor warranty only without spares running petrol only, grass cutter or weed cutter 2 stroke engine with weed cutter 250meter wire 2sets of blades 1 year service warranty period without spares only china make only no brand petrol and oil running, with push cart set and 3phase honda motor and pump 100 meter flexible hose cable 2no spray guns 250 ltr capacity tank 1 year warranty for motor out of service is free up to 1year spare are chargeable, battery & manual sprayer to wear the back side 16ltr capacity tank no warrant for battery only service warranty 6months without spares only , giantbigfogging machine 1.9 ltr consumption ltr per hr chemical tank 5ltr capacity hand pump 3 to 4 time then cahrgeble battery running 1 year service warranty only with spares and labour charge are extra. to diesel and petrol running only, mini small fogging machine to spray for mesquites no warranty product to use diesel and mini gas can, the composition of malathion tech 5.0% based on 95% chain clay 10% soapstone, toilet cake or odonil fragrance of wash room purpose only, bamboo ladder, mop small cloth to use office table and chairs cleaning purpose only, clip mop set it use moping purpose to office only, apron, sodium hypo chloride, weed control chemical, mask branded, gum boots branded, pvc hand gloves 16 inches, coco broom, soft broom, toilet cleaning acid, malathion oil 5.0% e.c, pesticide (fogging chemical with water mix), fogging chemical (with fuel mix), black phenyl, white scented phenyl, alum crystal, malathion dust 5.0%e.c, bleaching powder 33% chlorine, safety helmets, sanitizer

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42251244 Due date: 03 Nov, 202503 Nov, 2025 NA
Tender For supply of chemicals and consumables d d - l_methionine , phosphate buffer , edta , h2_o2 , borate buffer , l_phenylalanine , tri chloro acetic acid , hydrochloric acid , 2_ mercaptoethanol , 1m sodium buffer phosphate , pyrogallol , nitro_blue tetrazolium nbt chloride , pvp , riboflavin , guaiacol , triton x , tris hcl buffer , potato dextrose agar , nutrient agar , di sodium hydrogen phosphate , sodium di hydrogen phosphate , potassium hydroxide , sodium hypochlorite , lactophenol cotton blue , maxima sybr green_rox qpcr master mix 2x , revert aid first strand cdna synthesis kit , oat meal agar , streptomycin , permanent marker black , permanent marker red , micro tube racks 20 x 2ml , bluple nitrile examination gloves , non absorbent cotton wool , absorbent cotton wool , parafilm m125 , sterile disposable petri plates , disposable face masks , spatula 200 , wash bottle capacity 500ml , metaloop ch3 , thump press dispensing dropper , straight wire nichrome ) /bid number : gem/2025/b/6780307 * /dated: 11-10-2025 & & / bid document 1 / 32

Central Government/Public Sector

CTN :42149153 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For tender for supply of boq bid for chemical items d d - potassium phosphate monobasic solution 1l , potassium phosphate dibasic solution 1l , pyrogallol 10g , laminarin from laminaria digitata 500mg , chitin azure 100mg , pvdf membrane filter , 0.22 um pore size-durapore , filter diam. 25 mm , hydrophilic 2 pack , curcumin 500mg , bisdemethoxycurcumin 5mg , demethoxycurcumin 5mg , hexadecyltrimethylammonium bromide 100g , canada balsam 25ml , potassium nitrate 500g , potassium sulfate 500g , calcium chloride dihydrate 500g , magnesium sulfate heptahydrate 250g , manganese(ii) chloride tetrahydrate 500g , ammonium molybdate tetrahydrate 100g , zinc sulfate heptahydrate 500g , copper(ii) sulfate pentahydrate 500g , iron(ii) sulfate heptahydrate 500g , calcium nitrate tetrahydrate 500g , ammonium sulfate 500g , sodium molybdate dihydrate 500g , boric acid 500g , manganese sulphate monohydrate 500g , ammonium dihydrogen phosphate 500g , edta , disodium salt , dihydrate 100gm , o-phenanthroline 500mg , acetone 500ml , acetonitrile , hplc 500ml , methanol 500ml , formic acid hydrazide 25g , water , hplc 1l , hydrochloric acid abt.35% pure 500ml , acetic acid glacial , 1000ml , iodine resublimed 100g , sodium carbonate anhydrous , hi-ar 100g , folin and ciocalteus phenol reagent , 100ml , sodium nitrite , hi-lr 500g , sodium hydroxide pellets 500g , l-ascorbic acid 25g , citric acid anhydrous 500g , ethyl acetate , hi-lr 2.5l , ethyl acetate , hplc 1l , petroleum ether 40 - 60 c , hi-lr 500ml , gallic acid monohydrate 500g , potassium chloride 250g , curcumin 5g , 2 , 2-diphenyl-1-picrylhydrazyl 1g , sodium sulphate anhydrous 1kg , 3 , 5-dinitrobenzoic acid , hi-ar 100g , haematoxylin (mayer) 500 ml , di-sodium hydrogen phosphate anhydrous 500g , sodium dihydrogen phosphate monohydrate 500g , sodium potassium tartrate tetrahydrate 500g , potassium iodide 100g , phenol , crystals 100g , sodium acetate anhydrous 100g , bradford reagent 100ml , d-phenylalanine 5g , corn meal dextrose agar 500ml , cycloheximide 5g , streptomycin 1pk , sterile mineral oil 500ml , czapek dox agar , modified , granulated 500g , methyl red indicator 125ml , bromothymol blue indicator 125ml , potato carrot agar 500g , v8 juice agar 500g , 2 , 3 , 5 - triphenyltetrazolium chloride 25g , kings medium b base , granulated 500g , oat meal agar 500g , hiindicator ph paper 1pk , parafilmd m250x 5no , coverslip 200no , triangular s. s. spreader with bakelite hand 10no , sterile , disposable l-spreader 50no , potassium permanganate-500g 500g , potato dextrose agar w/ chloramphenicol 500g , potato dextrose broth , granulated 500gm 500g , standard nutrient agar 500gm 500g , nutrient broth 500gm 500g , glycerol- 500 ml 500ml , sodium hypochlorite 4% 500ml (100mlx5) 500ml , chloroform 500ml 500ml , gram staining kit 2kit 1kg , copper (ii) acetate monohydrate 500g 500g , acetic acid , glacial 1000ml 1000ml , agar powder , bacteriological grade 500g 500g , sucrose 500gm 500g , d-glucose 1kg 1kg , peptone type i , bacteriological 500gm 500g , beef extract 500gm 500g , yeast extract powder , type i 500gm 500g , sodium chloride 500gm 500g , lactophenol cotton blue 500ml 500ml , agarose 1000g 1kg , fixative (buffered formalin fixative) for fixing cytological or histological samples 500ml 500ml , casamino acid (caesin acid hydrolysate) 500gm 500g , microscope immersion oil (125ml) -125g , gibberellic acid 100 gm 100g , copper (ii) sulphate anhydrous 500g 500g , d-glucose anhydrous 100g 100g , trichoderma harzianum selective agar base for selective isolation of trichoderma harzianum. 500g , chloramphenicol 3kt 3kt , rose bengal agar base , granulated 500g 500g , non absorbing cotton rolls (pack of 5) 5no , stainless steel scalpel holder no. 3 (pack of 2) 2no , sterile scalpel blade no. 10 (100 number) 100no , nichrome loop-d-4 diameter 4 mm , double wound , calibrated to 0.01ml.(5 number) 5no , metaloop ch-3x changeable nichrome loop embedded in brass rod with heat resistant handle

Central Government/Public Sector

CTN :42097865 Due date: 23 Oct, 202523 Oct, 2025 NA
Tender For tender for supply of chemical for laboratory : : - ammonium molybdate , potassium sulphate , sodium hydroxide pellets , barium chloride , ferric chloride , pyrogallol , soda-lime (granulares) , iodine pentaoxide , potassium hydroxide pellets , p-dimethyl amino benzaldehyde , phenolphthalein indicator , urease active meal , silver nitrate , silver sulphate , potassium sodium tartrate , potassium iodide , sodium thiosulphate , tryptone , alkali blue 6-b indicator , boric acid , ferric citrate , zinc dust , cupric sulphate
 Loading, Please wait...

Connect us via What's Up