Latest pyrogallol Tenders | Government pyrogallol Tenders

Central Government/Public Sector

CTN :39697545

25 Apr, 2025 NA

Solapur - Maharashtra

Tender For corrigendum : supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , tric

CTN :39983731

08 May, 2025 11.00 Crore

Srinagar - Jammu And Kashmir

Tender For supply of veterinary drugs and medicines (allopathic) - each ml contains diaminazine aceturate / diaceturate 70 mg, phenazone bp 375 mg, chlorocresol ip 0.1%- rtu, solution containing closantal 15% w/v, each bolus containing albendazole usp1500mg, each ml contains albendazole usp ip/bp-100 mg, suspension containing:- rafoxanide ip/bp vet 3% w/v levamizole hcl ip/bp 3% w/v, suspension containing:- rafoxanide ip/bp vet 3% w/v levamizole hcl ip/bp 3% w/v, sol. containing:- oxyclozanide 3% w/v ip vet tetramisole ip 3% w/v, each ml contains doramectin 10 mg, each ml contains doramectin 10 mg, each bolus containing :closantal 1000 mg excipients qs, each bolus contains fenbendazole bp vet.3 gm, each bolus containing triclabendazole 900 mg, inj. each ml containing levamisole 75 mg, fenbendazole suspension 10%, piperazine hydrate- 61.0% w/v, each ml containing tricabendazole 50 mg, ivermectin 1mg, each 5 mlcontains niclosamide ip-500mg albendazole ip 150 mg, each tabs contains fenbendazole 150mg praziquantel- 50 mg, each bolus contains oxyfendazole ip vet- 2200 mg, each tabs contains fenbendazole 500mg praziquantel- 50 mg, pyrental pamote 144 mg, each ml contains fenbendazole 1.5 % w/v praziquantel 05%w/v, each ml contains fenbendazole 1.5 % w/v praziquantel 05%w/v, powder containing sulfaquinoxaline ip bp vet 18.7% w/w diaverdine bp vet 33% w/v, eac bolus contains albendazole ip 3gm cobalt cholride, each 100 ml contains piprazine hydrate ip 45 gm, each ml contains buparvoquone 50 mg, each ml injection conains lithium antamony thiomalate ip 60mg equivalent antimony trioxide 12 mg, each ml susp. containing oxyclozanide -6% levamisole 3% and silymarine 0.4%, each ml susp. containing oxyclozanide -6% levamisole 3% and silymarine 0.4%, each bolus contains oxyclozanide 4000 mg, levamisole 2000 mg & silymarine 300 mg, each ml contains imidocarb dipropionate 120 mg, each ml contains imidocarb dipropionate 120 mg, each bolus contains albendazole 3gm, ivermectinm 100mg, each ml contains ivermectin- bp 10 mg clorsunol usp 100 mg benzyl alcohol ip 1.5% w/w as perservative proplyene glycol q.s, each ml inj. containing meloxicam bp 20mg, each ml inj. containing meloxicam bp 20mg, lignocaine gel, each ml inj. containing:- lignocaine hcl ip 21.30 mg adrenaline (as adrenaline bitartarate) ip 0.009 mg to 0.005 mg sod. chloride ip 6 mg sod metabisulphate ip 0.5 mg methyl paraben ip 1 mg, each ml inj. containing tolfenamic acid ph eur 40mgbezyl alcohol 1.04% w/v, each ml inj. containing tolfenamic acid ph eur 40mgbezyl alcohol 1.04% w/v, each ml inj. containing dicyclomine hcl ip 10 m, each ml inj. containing flunixin meglumine 50 mg, each ml inj. containing flunixin meglumine 50 mg, inj. solution containing xylazine hcl ip 20mg/ml, inj. solution containing xylazine hcl ip 20mg/ml, each ml of injection containing parcetomol 150 mg, meloxicam bp 5 mg, each ml contains:- ketamine 100mg, benzethonium chloride,usp 0.1mg water for injection usp qs, each bolus contains nimesulide 400 mg, paracetamol 1500 mg, serratiopeptidase 75 mg, each ml injection contains nimesulide 100 mg petofenone 2 mg, fenpivernium 0.02 mg bromide banzle achol 4% v/v, each ml injection contains tolfenamic acid 80 mg, each ml injection containing nimesulide 30 mg and paracetamol 195 mg, inj. each ml contains phenyl butazone ip 1.50mg analgin ip 150mg lignocain hcl ip 10mg water for inj., each ml injection containing phenyl butazone ip 200 mg, sodium salicylate ip 20 mg, each ml injection contains:- 5mg diazepam, 40% propylenone glycol, 10% alcohol, 5% sodium benzoate and benzoic acid added ass buffers and 1.5% benzyl alcohol added as a preservative ph 6.6 ( 6.2 to 6.9)., each ml injection contains:- 5mg diazepam, 40% propylenone glycol, 10% alcohol, 5% sodium benzoate and benzoic acid added ass buffers and 1.5% benzyl alcohol added as a preservative ph 6.6 ( 6.2 to 6.9)., each ml injection contains:- 5mg diazepam, 40% propylenone glycol, 10% alcohol, 5% sodium benzoate and benzoic a

Corporations And Associations And Others

CTN :39999972

26 Apr, 2025 75.50 Lacs

Solan - Himachal Pradesh

Tender For purchase of chemical-, gelatine (food grade) veg. origin (duly supported with certificate) , bentonite activated food grade powder. , filter aid powder (food grade)-decalite/dicamol , citric acid (food grade and lr grade) qualikem make , ascorbic acid (food grade) , malic acid (food grade) , acetic acid (food grade) , k.m.s. (food grade) , common salt (dust free) , hydrogen peroxide 35% (food grade) , caustic soda flakes, caustic soda flakes , bleaching powder , pectin , potasslum grade) sorbate , (food , sodium benzoate (food grade) , caustic soda liquld 50% (food grade), ,

CTN :39622587

14 Apr, 2025 3.87 Lacs

Darjeeling - West Bengal

Tender For bid to ras tender for supply of efonidipine 40mg tab , glycopyrronium 25 mcg smartules , inj bcg vaccine 40 mg , nintedanib 100mg cap , oint (chlorhexidine gluconate 0dot20 w/w clobetasole propionate 0dot05 w/w miconazole 2 w/w neomycin 0dot5 w/w tube of 15 gm , oint neomycin / neosprin 5 gm tube , polyethylene glycol 0 dot 4 w v propylene glycol 0 dot 03 w v ophthalmic solution 10ml , povidone iodine gargle , sofosbuvir 400mg velpatasvir 100mg , sunscreen gel spf 40 60gm octinoxate diethylamino hydrobenzoyl hexyl benzoate bis , tab acenacumanol 3 mg , tab amloroid 5 mg frusemide 40 mg , tab atrovastatin 10 mg ezitimibe 10 mg , tab esomeprazole levosulpride , tab gingo biloba , tab isolazine 57dot5mg , tab nifedipine xl 30mg , tab prednisolone 30mg , tab sevelamer 800 mg , tab telmisartan 40mgamlodipine 5mg , tab warferin 2 mg , tab zinc 50mg , cap vit c 30 mg vit b3 25 mg fa 10 mg pantothenic acid 6 mg vit b2 3 mg , pulv neomycin bott 5 gm , tab carvidilol 25mg , tab alfuzocin 10 mg dutasteride 0dot5 mg , tab librax (librium 5mg clinidium2dot5mg) , hand gloves 7dot0 sterile , sterile cotton buds pkt of 100 , cap omega pack of 30 cap , dispo soft cervical collar , allopurinol 100 mg tab , oxcarbazepine 150 mg tab , tinidazole 500 mg tab , ondansetron 8 mg tab , tab topiramate 50 mg , diltiazem 60 mg tab , fenofibrate 200 mg tab , anticarious fluoride rinse mouthwash with sodium fluoride acidulated , chlorhexidine mouthwash 0dot12 sugar and alcohol free bottle of 450-500 ml in amber coloured bottle , silver sulphadiazine 1 cream w/v jar of 500 gms , flucinolone acetonide 0 dot 01 , hydroquinone 2 tretinoin 0dot025 tube of 20gml , insulin analogue long acting basal plus long acting glp 1 analogue in pfs pfp , apd fluid drain bag 15ltr , cinacalcet 60mg , spacer with mask for inhaler , vdrl test kit/strip , tab ferric citrate 210 mg (auryxia) , tab mosapride 0dot5mg , syp paracetamol 250 mg ibuprufen 200 mg 60 ml combiflam , oint 5 acyclovir cream 5 gm tube , test for widal test , hydralazine 25mg , tab tofisopam 50 mg , inj goserlin acetate 3dot6mg

CTN :39973688

25 Apr, 2025 14.96 Lacs

Madhugiri - Karnataka

Tender For supplying of drugs to general hospital madhugiri, tumakuru district - spinal needle 23gx3.50in (0.64mmx90mm) quincke point_ghm, n s 100 ml _ghm, sterial swab sticks_ghm , ecg leads _ghm, eythilion no.1_ghm, syp ambroxyll_ghm, vitamin d3 drops_ghm, syp cetrizine 60 ml_ghm, syp salbutamal_ghm, calamine lotion_ghm, benzyl benzoate lotion_ghm, vitamin k pediatric_ghm, inj mephentrimine_ghm, inj gentamycine_ghm, inj rabies vacine 2ml_ghm, inj adranaline _ghm, inj sodium bicarbonate_ghm, inj calcium gluconote 10 ml _ghm, inj waterfor_ghm, ors_ghm, iv paracetamol 1 gram_ghm, i v ns 500 ml_ghm, surgical blade no.11_ghm, surgical blade no.22_ghm, head cap_ghm, surgical glove no.7_ghm, surgical glove no.6 .5_ghm, surgical glove no.6_ghm, inj hydrocortizone 100 mg_ghm, inj dexomathasone 2ml vial_ghm, inj human rabies immunogolobulin 2ml_ghm, inj tranexaminic acid_ghm, inj diclofenac 3ml amps_ghm, inj hep - b 10 vial_ghm, inj insuline 30/70_ghm, tab dicyclomine_ghm, tab thaimine 100 mg_ghm, tab folic acid 400 mcg_ghm, tab amoxycillin 125 mg dis_ghm, tab ferous sulphate folic acid adult_ghm, tab paracetamal 250 mg_ghm, tab cinirazine 75mg_ghm, tab amlodipine 10 mg_ghm, tab aspirine 75 mg_ghm, tab chloropromazine 100 mg_ghm, tab clobazam 10mg_ghm, tab ranitidine 150mg_ghm, tab cefixime 200 mg_ghm, tab ciprofloxacine 500 mg_ghm , tab amlodipine 5 mg_ghm

CTN :39925929

16 Apr, 2025 6.54 Lacs

Ganganagar - Rajasthan

Tender For supply of lab chemicals at sstps(o and m),suratgarh.-, 1-amino-2-naphthol-4- , , sulphonic acid (1 pkt = 25 gm) , , ammonium chloride (1 pkt =500gm) , , ammonium molybdate tetrahydrate (1 pkt=500 gm) , , ammonium perpurate (1 pkt=5gm) , , acetone (1pkt= 500 ml) , , ammonia solution 25% (1 pkt=2.5 itr) , , acetic acid (1pkt= 2.5 ltr) , , bromo cresol green 0.04% indicator ph 3.6-5.2 yellowish-green (1pkt= 125 ml) , , bleaching powder (1 pkt =500 gm) , , conc. hydrochloric acid (1 pkt=500ml) , , chlorotex reagent (1 pkt =100 ml) , , diethyl ether (01 pkt=500 ml) , , ethanol (1 pkt =500 ml), , , etylene diamine tetra acetic acid disodium salt dihydrate (1pkt= 500gm) , , eriochrome/solochrome black -t (1pkt= 25gm) , , glycerol anhydrous (1 pkt =2.5 ltr) , , 1 n hydrochloric acid ampule (1 pkt= 06 no's) , , hexamine (1 pkt = 500 gm) , , hydroxyl amine hydrochloride (01 pkt=500 gm) , , isopropyl alcohol (1pkt= 2.5ltr) , , n/10 lodine ampule (1 pkt = 06 nos.) , , lead nitrate (1 pkt = 500 gm) , , methanol (1 pkt =2.5 ltr) , , methyl red 0.01% indicator solution ph 4.3-6.3 red-yellow (1pkt= 125 ml) , , mercuric thio cyanate (1 pkt= 100gm) , , nessler reagent (1 pkt = 100 ml) , , nitric acid (1 pkt= 2.5 ltr) , , oxalic acid (1 pkt =500 gm) , , o-toludine (1pkt= 500gm) , , para dimethyl amino benzaldehyde (1 pkt =500 gm) , , potassium hydroxide pellets (1 pkt =500 gm) , , e , , pyrogallol (1 pkt =100 gm) , , 1,10 phenenthroline (1pkt=5gm) , , phenophthalein indicator (1 pkt =125 ml), , , ph indicator paper (ph 1.0-14.0) with colour scale , , sodium meta bisulphite (1 pkt =500 gm), , , sodium sulphite (1 pkt =500 gm), , , sulphuric acid (1 pkt =2.5 ltr) , , sodium acetate (1pkt= 500gm) , , sodium hydroxide pellets (1pkt= 500gm) , , starch soluble (1pkt=500gm) , , n/10 sodium thio sulphate ampule , , silicone high vaccum grease (lab) (1pkt= 50 gm) , , 1 n sodium hydroxide ampule (1 pkt = 06 nos.) , , sodium potassium tartarate (1pkt=500gm) , , silver nitrate (01 pkt=100 gm) , , standard silica (1000 ppm) (1 pkt=500 ml) , , toluene (1pkt= 2.5 ltr) , , universal indicator ph 4-11 indicator with colour chart (1 pkt =500 ml), , , xylene (sulphur free) (1 pkt= 2.5ltr) , , xylenol orange indicator(01 , , pkt=10 gm) ,

State Government

CTN :39887239

21 Apr, 2025 NA

Yavatmal - Maharashtra

Tender For tender for supply of medicines and consumables for the year 2024-25 and 2025-26 - tab. cetrizine hydrochloride 10mg, syp. cetrizine 5mg/5ml 30ml, inj. pheniramine maleate22.75mg/2ml, iron folic acid liquid 200ml, tab. folic acid 5mg, inj. atropine0.6mg/mlsulphare 1ml, cap. amoxycillin 250mg, cap. amoxycillin 500mg, syp. amoxycillin+ clavulanic acid dry syp. 200mg+28.5mg /5ml 30ml bottle, tab. amoxycillin+clavulanic acid 250+125mg, tab. amoxycillin+clavulanic acid 500+125mg, tab. cefixime 200mg, inj. ceftriaxone 500mg vial, inj. ceftriaxone 1gm vial, cap. doxycycilline 100mg, inj. gentamycin 40mg/2ml, tab. ciprofloxacin 250mg, tab. ciprofloxacin 500mg, tab. azithromycine 500mg, syp. azithromycin 200mg/5ml15ml, tab. ofloxacin 200mg, tab. metronidazole 200mg, tab. metronidazole 400mg, syp. metronidazole 60ml, i.v. metronidazole 100ml, tab. tinidazole 300mg, tab. metformin 500mg, tab. glimiperide 2mg, oral rehydration salt powder who farmula 20.5gms, tab. ondansetran 4mg, inj. ondansetran 2mg/ml 2ml amp, tab. flucanozole 150mg, tab. glimiperide 1mg, tab. telmistran 40mgs, tab. amlodepine 5mg, tab. atenolol 25mg, tab. atenolol 50mg, syp. antacid 170ml, cap. omeprazole 20mg, inj. pantoprazole 40mg/10ml, tab. acetyl salicylic acid 75 mg ip (aspirin ), tab. dicyclomine hydrochloride 10mg, inj. dicyclomine hcl 10mg/ 2ml, sodium hypochloride solution 200ml, sodium hypochlorite solution 5000 ml, syp. lactulose 667mg/ml 100ml, inj. paracetamol 150mg/2ml amp, paracetamol drop 150mg/ml 15ml, tab. paracetamol 500mg, syp. paracetamol 250mg/5 ml /60ml, inj. diclofenac sodium 25mg/ml/3ml amp, tab. diclofenac sodium 50 mg, diclofenac gel 30gm 1%, syp. ibuprofen 100mg/5ml 60ml, tab. calcium carbonate+vit d3 1.25gm, syp. calcium 200ml, inj. oxytocin 5iu 1ml, tab. salbutamal 4mgs, syp. cough expt. 100ml, i.v. normal saline 0.9% 100ml, i.v. n.s. 500ml, i.v. dextrose 5% 500ml, i.v. ringer lactate 500ml, sterile water for injection 5ml, inj . dexamethasone 4mg/2ml, dexamethasone tab., i.v. dextrose with normal saline 5% 500ml., surgical spirit 500ml, tincture benzoin bottle 500ml, povidone iodine ointment 5% 15gm, clotrimazole cream 1% 15gm, miconazole cream 2% 15 gm ip, anti rabies vaccine im (human tissue culture) 0.5ml, anti rabies vaccine id (human tissue culture) 0.5ml, tetanus toxoid 40 adsorbed 41i.p., tab. vit-b-complex nfi, tab. ascorbic acid 500mg, sterile water for injection 10ml, i.v. ciprofloxacin 200mg/100ml, tab. azithromycin 250mg, ferric carboxy maltose 500mg inj., syp. ondansetran 2mg/5ml 30ml, inj. promethazine 25mg/2ml, inj. pentazocine 1ml, povidone iodine solution scrub 7. 5% 500ml, tab. ifa (60 mg + folic acid 500 mcg (wifs) blue coloured tablet, iron folic acid syrup with auto dispenser 5o ml bottle, tab. ifa containing 45 mg elemetal iron & 400 mcg folic acid pink tab, tab. folic acid 400 mcg, inj. iron sucrose 50mg in 2.5ml amp, fluconazole oint. tube 15gm, ciprofloxacin eye/ear drop, trimethoprim + sulphamethoxazole susp., pantoprazole tab., ciprofloxacin + dexamethasone eye drops, inj magnesium sulphate 50% w/v, antiscorpion venum serum inj, cholecalciferol 60000 iu granules sachet, hydrogen peroxide ip, ferrous fumarate syrup, vitamin a capsule, vitamin a concetrated solution, clotrimazole lotion, benzyl benzoate lotion, chloramphenicol eye applicaps, syrup furazolidone, etofylline + theophylline inj, diazepam inj., amoxycillin syrup, tab. etophyllin + theophyillin sr, isosorbide dinitrate tab, metoclopramide tab, sodium bicarbonate inj., adrenaline lnj. lmg/ml, prednisolone tab, povidone iodine solution, lignocaine hci i.p inj., antisnake venom serum strerile powder with strerile water, lyophilized sterile solution 10ml, frusemide inj., moxifloxacin eye drop, povidone mouth gargle 2%, trimethoprim + sulphamethoxazole ss tab., furazolidone tab, iron+ folic acid tab 130 mg of elemental iron+ folic acid 250mcg), albendazole tab, albendazole susp., ibuprofen tab.400 mg, ibuprofen tab.200 mg, cefotaxime inj 500 mg, amikaci

CTN :39881459

21 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of indl first aid kit , febendazole 25 percent bott of 120 gm , gentamycin sulphate inj each ml containing gentamycin sulphate ip equivalent to 40 mg of gentamycin base vial of 10 ml , skin application containing miconazole nitrate 2 percent w by w gentamycin 0 point 0025 percent w by w bott of 30 ml , serum gonadotrophin inj pregnant mares serum in amp of 1000 iu with 2 ml amp of sterile water , antispasmodic containing dicyclomine hcl 10 mg per ml vial of 2 ml inj , ivermectin inj 1 percent w by v amp of 7 ml , ear sol each 10 ml containing cephalexin monohydrate 200 mg gentamycin sulphate 166 point 7 mg dexamethasone sodium phosphate 0 per 75 mg vit a palmitate 5 point 9 mg excipients qs bott , ketoprofen inj 100 mg per ml vial of 15 ml , lyphilized chrionic gonadotrophin inj 1500 iu per vial of 5 ml , vit and min supplement in ment flav tab cont ca 2 pnt 503 pnt 5 perc p 2 pnt 5 perc k 0 pnt 4 perc salt 0 pnt 100 pnt 6 perc chl 0 pnt 1 perc cu 0 pnt 1 mg mn 0 pnt 25 mg zn 1 pnt 4 mg vit a d e , cal suppl for dog each 20 ml containing calcium 250 mg phosphorus 280 mg vit d3 1600 iu vit b 12 20 mcg bott , pow live yaest culture with cell me tabolites pkt of 1 kg , suspension metronidazole benzoate and norfloxacin each 5 ml containing 100 mg of metronidazole and 100 mg of norfloxacin bott , metronidazole 1 gm and furazolidone 200 mg tab , mecobalamin with b complex vial of 30 ml inj , oxytetracycline dihydrate inj 200 mg per ml in 2 pyrrilidone vial of 50 ml , phenylbutazone 20 percent inj amp of 3 ml , calcium 700 mg phosphorus 400 mg magnesium 00 point 5 mg vit d 3 400 iu , inj containing n butanol 0 point 26 gm citric acid 0 point 0025 gm and physical saline 5 ml inj of 5 ml amp , turpentine oil , tocopheryl acetate and selenium e care se inj vial of 10 ml , vit a inj concentrate 300000 per ml amp of 2 ml , weak iodine sol tincture iodine bott of 500 ml , inj yohimbine hcl 10 mg per ml vial of 20 ml , glucosamine hcl 1800 mg sodium chondroitin sulphate 600 mg mgso4 16 mg ascorbic acid 104 mg per 3 point 3 gm of powder concentrate sachet , oxytetracycline spray containing oxytetracycline 5 gm gentian violet 0 point 7 gm container , anti tetanous immunoglobulin tetanus immune globulin tig and tetanus antitoxin 250 iu bid details/ 2 / 27

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39818593

15 Apr, 2025 9.00 Lacs

Ganganagar - Rajasthan

Tender For purchasing of medicine-, ketamine injection 50 mg/ml, , morphine sulphate injection ip 10 mg/ml, , pentazocine injection 30 mg/ml, , fentanyl citrate injection 50 mcg/ml, , fentanyl citrate injection 50 mcg/ml, , aspirin tablet ip (gastro-resistant) 150 mg, , ibuprofen oral suspension 100 mg/5ml, , indomethacin capsule 25 mg, , tab tizanidine hydrochloride ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg), , naloxone injection ip 0.4 mg/ml, , carbamazepine tablet 200 mg, , carbamazepine tablet ip 100 mg, , carbamazepine oral suspension usp 100 mg/5 ml, , phenobarbitone injection ip 200 mg/ml, , amoxicillin and clavulanic acid injection 600 mg, , cefepime injection 500 mg, , co-trimoxazole oral suspension 40 mg + 200 mg per 5ml, , co-trimoxazole tablet 40 mg + 200 mg, , framycetin sulphate cream 1% 25gm, , framycetin sulphate cream 1% 100gm, , metronidazole benzoate oral suspension 100 mg/5 ml, , metronidazole tablet 200 mg, , diethylcarbamazine tablets ip 100 mg, , griseofulvin tablets 125 mg, , mefloquine tablet 250 mg, , quinine dihydrochloride injection 300 mg/ml, , quinine sulphate tablet 300 mg, , act kit containing 3 tablet of artesunate (each tablet of artesunate 25mg strength) and 1 tablet of sulphadoxine pyremethamine (250 mg+ 12.5 mg), , act kit containing 3 tablet of artesunate (50mg each) and 1tablet of sulphadoxine pyremethamine (500+25) mg, , act kit containing 3 tablet of artesunate (100 mg each) and 1 tablet of sulphadoxine pyremethamine (750 + 37.5) mg, , act kit containing 3 tablet of artesunate 150 mg and 2 tablet of sulphadoxine pyremethamine (500 mg+ 25 mg), , act kit containing 3 tablet of artesunate (each 200 mg) and 2 tablet of sulphadoxine pyremethamine (750 + 37.5) mg each or 3 tablet sulphadoxine pyremethamine (500+25) mg each, , artemether + leumefantrine tablet (40 mg and 240 mg), , acyclovir suspension 400 mg/5ml, , bleomycin injection 15 units, , cyclophosphamide injection 200 mg, , cyclophosphamide injection ip 500 mg, , cytarabine injection 100 mg/5 ml, , l-asparaginase injection 10000 iu, , melphalan tablet 5 mg, , mercaptopurine tablet ip 50 mg, , methotrexate injection 50 mg/2 ml, , alpha interferon injection 3 million unit, , tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg), , tab. 6 thioguanine usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg), , tab dasatinib 100 mg, , levodopa and carbidopa tablet 100 mg + 10 mg, , levodopa and carbidopa tablet 250 mg + 25mg, , feracrylum 1% w/w sterile solution 100 ml, , dried factor viii fraction (iv use) 250 iu, , dried factor viii fraction (iv use) 500 iu, , dried factor viii fraction (iv use) 1000 iu, , factor - ix concentrate 600 iu, , anti- inhibitor coagulation complex [human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu], , recombinant coagulation factor vila - 1 mg, , recombinant coagulation factor vila - 2 mg, , recombinant f ix 500 iu with diluent, , 3rd generation recombinant f viii 250 iu with diluent, , 3rd generation recombinant f viii 1000 iu with diluent, , deferasirox tablet 100 mg, , deferasirox tablet 500 mg, , deferiprone capsules 250mg, , deferiprone capsules 500mg, , desferrioxamine injection (for i.m. inj and i.v., s.c. infusion) 500 mg, , adenosine injection 6 mg/2ml, , amiodarone hydrochloride injection 50 mg/ml, , verapamil tablets ip 40 mg, , urokinase injection 5 lac unit, , aspirin delayed release tablet (enteric coated) 75 mg, , amlodipine and enalapril maleate tablet 5 mg +5mg, , methyldopa tablet 250 mg, , nifedipine capsule 5 mg, , inj. esmolol hydrochloride 10mg/ml 10ml size, , inj. sodium nitroprusside 25mg/ml 2ml size, , digoxin injection 0.25 mg/ml, , isoprenaline injection 2mg / ml, , betamethasone dipropionate cream 0.05%, , coal tar 6% & salicylic acid 3% onitment, , lohexol usp (solution for injection) non ionic contrast medium in ster

Pyrogallol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Corporations And Associations And Others

State Government

Central Government/Public Sector

State Government