Latest reagent bottle Tenders | Government reagent bottle Tenders

CTN :42121084

22 Oct, 2025 NA

Gandhinagar - Gujarat

Tender For supply of procurement of chemicals glassware and miscellaneous items c c - 3 4 dinitrosalicyclic acid , 4 methyl catechol , 5 5 dithiobis 2nitrobenzoic acid dtnb 98 percent ellmans reagent , acetate buffer , acetone , agar agar powder , amphotericin b , ascorbic acid solution , boric acid , bouins fluid , cedar wood oil , chitin , chloramphenicol , citrate buffer ph 6.1 , deet diethyltoulamide , dimethyl sulfoxide dmso , disodium hydrogen phosphate , edta , ethyl acetate , formaldehyde , glycerine , gram stains kit , guaiacol solution , h2o2 solution , hcl , hydroxylamine hydrochloride , isopropyl alcohol , lactophenol cotton blue , l phenylalanine , methanol , methionine , methyl 4 hydroxybenzoate , n-acetyl glucosamine , nitric acid hno3 , nitroblue tetrazolium nbt , nutrient agar , perchloric acid , petroleum ether 40 to 60 , phenol , potassium bitartrate rochelle salt , potassium hydroxide , potassium permanganate kmno4 , potassium phosphate dibasic , potassium phosphate monobasic , potassium sodium tartrate tetrahydrate , potato dextrose agar , pure superoxide dismutase , riboflavin , sodium bicarbonate , sodium carbonate , sodium carbonate buffer , sodium chloride , sodium citrate dihydrate , sodium hydroxide , sodium hypochlorite solution 4 percent , sodium sulfite , sodium tetraborate , sorbic acid , sulphuric acid h2so4 , tris hcl , tritonx , tween 20 , xylene , yeast powder , beakers 25 ml , beakers50 ml , beakers 100 ml , beakers250 ml , beakers500 ml , beakers 1000 ml , reagent bottle with screw caps 10 ml , reagent bottles with screw caps 25 ml , reagent bottles with screw caps 50 ml , reagent bottles with screw caps 100 ml , reagent bottles with screw caps 250 ml , reagent bottles with screw caps 500 ml , reagent bottles with screw caps 1000 ml1000 ml , reagent bottles with screw caps 10 ml , reagent bottles with screw caps50 ml , graduated cylinder 5 ml , graduated cylinder10 ml , graduated cylinder25 ml , graduated cylinder50 ml , graduated cylinder100 ml , graduated cylinder 250 ml , graduated cylinders 500 ml , graduated cylinders 1000 ml , conical flask50 ml , conical flask 100 ml , conical flask 250 ml , conical flask500 ml , conical flask1000 ml , conical flask2000 ml , mohr pipette1 ml , mohr pipette10 ml , mohr pipette25 ml , glass stirrer rod9 x 255 mm , glass stirrer rod7 x 150 mm , glass slides 76 x 26 x 1 mm , cover slips24 x 24 mm , test tubes 15 ml , thermometerlength 305mm, immersion level 76 mm , culture petri dishes90 x 15 mm , culture petri dishes80 x 17 mm , funnels 75 mm , buchner filtration funnels 200 ml , buchner vacuum filtration funnels 500 ml , filtering flask buchner with side arm socket200 ml , vacuum filtering flasks buchner with side arm socket500 ml , flat bottom evaporating dish250-300 ml , flat bottom evaporating dish1700-2000 ml , watch glasses80mm , crystalizing dishes2500 ml , desiccator set , separating funnel- pear shaped500ml , separating funnel pear shaped1000ml , storage and sampling vials clear with write on patch5ml , storage and sampling vials clear with write on patch10ml , burette50 ml , filter paper , ptfe filter paper , pvdf filter paper , forceps 4 inch , forceps 6 inch , forceps 5 inch , forceps blunt 10 inch , spatula 12 inch , spatula 8 inch , cork borer set , rubber bulb , bunsen burner , thermometer , magnetic stirring bar retriever , neubauer chamber , cryo gloves , nitrile gloves medium , centrifuge tubes 50 ml , centrifuge tube 15 ml , falcon tube,centrifuge rack holder , parafilm m roll , wash bottle //bid details 2 / 115 , eppendorf tube , funnels , lab eye protection goggles , test tube rack , test tube basket , draining tray //bid details 3 / 115

Central Government/Public Sector

CTN :42131014

24 Oct, 2025 NA

Multi City - Multi State

Tender For supply of variable micro pipette,variable micro pipette,glass stirrer rod,cuvette quartz,drying rack, detachable pegs,chemical resistance gloves,micro pipette stand,universal micro pipette tip,universal micro pipette tip,empty tip box,glass pipette,mortar pestle,beaker,funnel,funnel,thermometer,surgical mask,laboratory plastic tray,spatula,reagent bottle,whatmen filter paper 1,,amber beaker,amber conical flask,amber reagent bottle,amber reagent bottle,tedlar bag,filter glass crucibles,beaker with spout,conical flask,conical flask,ldpe plastic wash bottle,burette,measuring cylinder,measuring cylinder,volumetric flask,volumetric flask,volumetric flask,pipette bulb,alumina boat,alumina crucible with lid,quartz crucible with lid

Central Government And Public Sector

CTN :42131749

24 Oct, 2025 NA

Multi City - Multi State

Tender For supply of sulphate standard solution,lab chemical,potassium chloride solution,sodium thiosulfate pentahydrate,nitrate ionic strength adjuster,orion tisab iii,sodium hydroxide pellets low chloride,bromocresol green,nitrate standard solution,ammonium heptamolybdate tetrahydrate,nitrate referance electrode,sodium iodide for analysis emsure 100gm,buffer solution ph 7 500ml,buffer solution ph 9 500ml,curcumin for synthesis 2 g,volumetric flask 25 ml,bod bottle 300 ml,serological pipette 10 ml,burette with glass stopcock, nabl cert., 50 ml,china dish 50 ml,electrade conductivity tds meter,reagent bottle hdpe,laboratory tray small,microtips for transferpette 0.5-5ml,reagent bottle 125 ml hdpe,microtips for micropipette,magnetic bar,nitrile gloves, pack 100

corporations/Associations/Others

CTN :42096590

20 Oct, 2025 NA

Jaipur - Rajasthan

Tender For supply of formalin , glycerin , phenol , dissection instrument kit , phenoxy ethanol , thymol , turpentine oil , methanol , eosin , bone cutter , nylone thread , bed sheets for cadaver , silicon tape for museum jars , antisera or blood group kit , leishmans stain , turks fluid, wbc diluting fluid , hayems fluid, rbc diluting fluid , glacial acetic acid , cedar wood oil , n bye 10 hcl , spirit , lancet or pricking needles , distilled water , eosinophil fluid , platelate fluid , reticulocyte fluid , cotton swab , xylene , whatman filter paper , glass capillary tubes , watch glasses , glass dropper , glass slide , glass cover slips , dropping bottle , slide box , test tube , test tube stand , scrubbing brush , staining rack , dropping bottle amber or brown colored , dropper graduated , tripod stand or round tripod stand , wire gauze , test tube stand , test tube holder , whatmans filter paper , ordinary filter paper sheet , toilet tissue paper roll , test tube brush , test tube brush , wash bottle , spirit lamp , reagent bottle amber color 2000 ml. , reagent bottle amber color 1000 ml. , reagent bottle amber color 250 ml. , burette , burette stand , bottle umber or bown colored , benedicts reagent, readymade , sodium nitroprusside pure lr , solid ammonium sulphate , ammonia solution lr , sulphur powder , benzidine solid , hydrogen peroxide 6 percent , chlorophenol red indicator , concentrated nitric acid , sulfosalicylic acid 3 percent , dextrose lr , albumin bovine , bile salts powder , acetone , ammonium oxalate lr , ammonium molybdate , silver nitrate , barium chloride , hydrochloric acid , sulphuric acid , ortho toluidine ) /bid number : gem/2025/b/6670389 * /dated: 29-09-2025 & & / bid document 1 / 66

Central Government/Public Sector

CTN :42097946

20 Oct, 2025 NA

Bathinda - Punjab

Tender For tender for supply of sundry job in central lab and plant lab : : - general cleaning of lab shelves benches working tables reagent bottles glass wares and instruments etc , to carry samples from various plants and sites as per nit details , preparation of coal samples grinding sieving , cutting testing of hdpe bags 216 test specimens per lot , preparation of scale samples by grinding etc , shifting of hvs machines to air monitoring station no1 2 3 for sampling etc , shifting of stack monitoring kit to sgp gtg ammonia urea prilling tower etc , assistance for work room study , assistance for boundary wall sampling , shifting of material like lpg o2 h2 n2 and he cylinders chemicals glassware and instrument etc as per nit details , shifting of instruments quipments for repairs etc from central lab plant labs to instrument mechanical electrical workshop stores etc as per nit , to deliver dak as per nit , plant labs as per nit , supply of extra manpower as per nit , upkeep of floors washroom and peripheral area of central lab , cleaning of agrochemical labs floors slabs and sample collection

Central Government/Public Sector

CTN :42109616

21 Oct, 2025 5.96 Lacs

Aliganj - Uttar Pradesh

Tender For supply of volumetric flask , amber volumetric flask 100 ml class a , amber volumetric flask 250 ml class a , beaker , wash bottle , aspirator bottle with stopcock , jerry cane , jerry cane , bottle , reagent bottle , reagent bottle , centrifuge tube box for 15 ml tubes , mask , buchner funnel , funnel , large carboy funnel , burette , whatmann filter paper no 40 , filter paper , aluminium cups , weighing boat , permanent marker

CTN :42090943

13 Oct, 2025 54

Dakshina Kannada - Karnataka

Tender For supply of laboratory materials under national tuberculosis elimination programme in dakshina kannada district - dk-glass reagent bottle, dk-rubber bands, dk-vortex mixer , dk-water bath, dk-micro pipette, dk-measuring cylinder b, dk-measuring cylinder a, dk-round bottom flask, dk-flat bottom flask, dk-conical flask, dk-electronic balance, dk-mercury free thermometer, dk-falcon tube holder, dk-staining rod (glass), dk-sodium hypochlorite, dk-alcoholic handrub antiseptic with moisturiser, dk-micro slide box, dk-brown tape, dk-transparent tape, dk-plastic zip-lock packing bag d, dk-plastic zip-lock packing bag c, dk-plastic zip-lock packing bag b, dk-plastic zip-lock packing bag a, dk-surgical glove-large, dk-surgical glove, dk-cotton roll, dk-face mask, dk-n 95 mask, dk-potassium permanganate purified (kmno4), dk-hydrochloric acid (hcl), dk-auramine o, dk-liquid parafin (heavy grade), dk-spiritol, dk-spirit lamp, dk-ethanol, dk-parafilm tape, dk-lens cleaning paper, dk-falcon tubes, dk-diamond marker, dk-filter paper (pkt of 100 nos), dk-tissue paper rolls, dk-phenol liquid (40%), dk-mythelated spirit, dk-thermacol box,gel pack with stickers b, dk-thermacol box,gel pack with stickers a, dk-phenol crystals, dk-adhessive label, dk-methyline blue, dk-con.sulphuric acid, dk-distilled water, dk-carbol fuchsin dye, dk-bamboo sticks, dk-glass slides, dk-sputum container

CTN :41897678

17 Oct, 2025 60.51 Lacs

Shimoga - Karnataka

Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles

CTN :41819161

11 Oct, 2025 29.77 Lacs

Shimoga - Karnataka

Tender For kfd rt-pct testing rna kits and consumables for virus diagnostic lanoratory shimoga for fy-2025-26 - rna extraction manual kit pack of 250 rxn for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96, 24 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96 96 well for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,24 well well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,96 well to be filled with reagents for vdl laboratory, small safe skin purple nitrile gloves 12inch extended cuff pack of 50 aql 1.5 astm 6319 standard gauge thickness measurements mm mil middle finger .15 5.9,palm .12 4.7, cuff.09 3.5 pack of 50 for vdl laboratory, cryo box 100 places paper for vdl laboratory, digital thermometer ilr for vdl laboratory, digital thermometer deep freezer-20 for vdl laboratory, amber color screw capped eppendorf tubes 2ml pack of 500 for vdl laboratory, te 1x buffer ph 8.0 rnase free 500ml for vdl laboratory, kim wipes lint free tissue white colour 4.4 inch x 8.4 inch 280 sheets is 1 unit for vdl laboratory, ice packs gel 20gms pack for vdl laboratory, filter tips racked low retention autoclavable with aerosal filter,universal size compatible with all micropipettes, free of detectable dnase,rnase,human dna pcr,hydrophobic polyethylene filters 10ul pack of 96 x10 box for vdl laboratory, cryochill external thread vial self standing sterile 1.8 ml pack of 1000 for vdl laboratory, permanent autoclave-resistant labels for vdl laboratory, buoffant caps- head cap(pack of 100) for vdl laboratory, ziplocks covers 5x7 in kg for vdl laboratory, ziplocks covers 8x10 in kg for vdl laboratory, cutter (paper knife) for vdl laboratory, dust pan for vdl laboratory, three bucket mopping for vdl laboratory, wet mop for vdl laboratory, dry dust control mop for vdl laboratory, hypoclorite solution5% 5ltr for vdl laboratory, disinfectctant cleaner (lyzol type)5ltr for vdl laboratory

Central Government/Public Sector

CTN :41489566

13 Oct, 2025 1.00 Crore

Noida - Uttar Pradesh

Tender For corrigendum : open tender document for e-procurement of laboratory equipment (soil, aggregates, cement, reinforcing bar, concrete test equipment, water, geo-textile and geogrid) for material testing laboratory of iahe - soil, unconfined compressive strengthcompression device with digital load frame: hydraulic proving ring, dial gauge vernier callipers, timer, oven, weighing balance, shear strength vane shear apparatus, grain size analysis as per is:2720 (part- iv)pipette apparatus (i) sampling pipette (ii) glass sedimentation tubes (iii) weighing bottles (iv) deleted (v) stirring apparatus (vi) sieves -2mm, 425umm , 75umm is sieves (vii) deleted, specific gravityhydrometer apparatus: two 1000 ml graduated cylinders, dispersing agent solution containing sodiumhexa-metaphosphate, dessicator and centimetre scale., shrinkage limit testfull set of equipments 1.) evaporating dish of porcelain, 2.) spatula and straight edge, 3.) balance-sensitive to 0.01 g minimum.4.) shrinkage dish. circular, porcelain or non-corroding metal dish, 5.) glass cup. 50-55 mm in diameter and 25 mm in height,6.) glass plates. two, 75x75 mm one plate of plain glass and the other prongs, 7.) thermostatically controlled oven,8.) wash bottle containing distilled water, 9.) graduate-glass, with capacity of 25 ml. 10.) mercury., sand equivalent value(i) graduated cylinder (ii) irrigator tube (iii) siphon assembly (iv) weighted foot assembly (v) measuring can (vi) sieve -4.75mm (vii) funnel (viii) 4- litre bottle (ix) flat pan (x) timing device (xi) sand equivalent shaker, ph test -electronic method(i) ph meter (ii) digital balance 300 gm capacity-sensitive 0.001gm (iii) 100ml glass beaker -3nos. (iv) volumetric flask-500ml -nos. (v) wash bottle-100 ml (vi) mortar with rubber covered pestle, aggregates, polished stone value (i) accelerated polish machine mounted on firm ,level and non resilient base of stone or concrete (ii) road wheel (iii) means for rotating road wheel (iv) means for bringing the surface of a rubber-tyred wheel of 20 cm diameter and 5 cm breadth to bear on the stone surface of the road wheel with a total load of 40 kg. (v) means to feed the sand and water at a uniform rate (vi ) means to feed the emery powder and water at uniform rate (vii) friction tester: is: 2386 part 4 as per specification of rrl uk (viii) 25 kg hard siliceous sand (ix) emery powder 5 kg, alkali aggregate reactivitymortar bar method: scales, weights, sieves, glass graduates, specimen moulds, mixing bowl, tamper, trowel, containers, length comparator, alkali aggregate reactivity chemical method:1. electronic balance2. pulveriser3. reaction container, reagents, glassware, petrographic examination 1. geological hammer2. petrographic microscope3. screen confirming to is sieve4. digital balance5. portable handheld cutting machine6. hand lens7. glass sides etc., deleterious material & organic impuritiessedimentation pipette: a watertight screw-topped glass jar, 1000 ml measuring cylinder, chemicals, containers, sieves, cement, soundness (autoclave apparatus)graduated glass cylinders, moulds, autoclave, length comparator, compaction (mortar cube vibrator), fineness (blaine air permeability apparatus), ph meter ( 2 in nos.), reinforcing bar (steel), reinforcing bar (steel) universal testing machine,to determine unit weight, yield strength,, proof stress, ultimate tensile strength, % elongation, bend and re-bend test, concrete test equipment, vibrating table 1mx1m(full set of equipments), needle vibrator ( 2 in nos.), permeability, dry shrinkage (shrinkage apparatus) ( 2 in nos.)(full set of equipments), air content (air entrainment meter apparatus)(full set of equipments), durability (rapid chloride ion permissibility apparatus), depth of penetration (water permeability apparatus) ( 2 in nos.)(full set of equipments), water, physical analysis of water, geo textile and geogrid, pull-out resistance of geotextile /geogrid

Reagent Bottle Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government And Public Sector

corporations/Associations/Others

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector