Web Analytics Made Easy - StatCounter

Reagent Item Tenders

Get complete information related to latest Reagent Item Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Reagent Item Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Reagent Item Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39562351 Due date: 07 Apr, 202507 Apr, 2025 NA
Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39482582 Due date: 08 Apr, 202508 Apr, 2025 NA
Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

CTN :39804397 Due date: 31 Mar, 202531 Mar, 2025 NA
Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

CTN :39322122 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For bid to ras corrigendum : procurment of lab reagents - cled agar , kit for estimation of cpk , prothrombin time reagents , pttk reagent , occult blood test , d dimer ichroma , kit for estimation of cpk-mb , pt reagent , biofix cytofix spray , pa colifrom kit , snap pack for eletrolyte analyser , kit for csf microprotien , transasia erba h360 control , transasia erba h360 calibrator , transasia erba h360 elit h clean , transasia erba h360 lyse , transasia erba h360 dil , haematology 5 part h560 lyse 1 , haematology 5 part h560 lyse 2 , heamatology 5 part h560 diluent 1 , transasia erba h560 control , combi disk gn1 abst , combi disk gn2 abst , combi disk gp1 abst , erba wash kit , uristix albumin and glucose , surgical spirit , band aid , kit for lipase , microscope lens cleaning solution , haematoxylin and eosin stain , pencil marking glass , hba1c fully automated em 200 xl system pack , ckmb fully automated em 200 xl system , anti hev , ldh fully automated em 200 xl system pack , ada fully automated em 200 xl system pack , erba norm kit fully automated em 200 xl system pack , erba path kit fully automated em 200 xl system , xl multical fully automated em 200 xl system pack , mac conkey broth powder , micro albumin , micro protein , cytochrome stain kit , erba auto wash , erba auto wash fully automated , anti hav

CTN :39809779 Due date: 14 Apr, 202514 Apr, 2025 18.95 Lacs
Tender For supply of hiv elisa kit of 50 test - hiv elisa kit of 50 test , hbaag elisa kit of 50 test , hcv elisa kit of 50 test , vdrl test kit of 50 test , hiv 1 and 2 rapid test 4 generation kit of 50 test , hbsag rapid test kit of 50 test , hcv rapid test kit of 50 test , hemocue microcuvetters for hb percentage estimation , temp chart recorder for blood bank refrigerator 2c to 10c helmer , temp chart recorder for blood bank refrigerator 2c to 10c remi , esr test tube westergren method , tlc diluting fluid 100ml , rbc diluting fluid 100ml , giema stain readymade , reticulocyte stain 500 ml ready made cytochrome , leishman stain 500ml ready made cytochrome , phosphate buffer ph7.0 , glass tube 10 ml , rapid aso titre kit 20 test , rapid widal test kit 4 x 5 ml , grcott stain bott of 100 ml , pas stain bott of 100 ml , chlorofoam ar bott of 500 ml , acetone bott of 500 ml , emirsion oil for microscope bott of 30 ml , liquor ammonia bott of 500 ml , vaccutainer edta for paedriatric , vaccutainer sterile for paedriatric , glucose powder , blood cultur bottle adult , blood cultur bottle paediatric , swab stick sterile , syringe 2 ml , syringe 5 ml , syringe 10 ml , syringe 50 ml , vaccutainer sterile tube with needle gel 5 ml , vaccutainer sterile tube with needle without gel 5 ml , vaccutainer edta 3ml with needle , vaccutainer sodium flouride 5 ml with needle , vaccutainer sodium citrate 3 ml with needle , tourniquete , micropipettes tips for 1-200 iu pkt of 1000 , tissue embedding ring plastic white, 1 cm height form base , tissue embedding ring plastic orange 1 cm height form base , tissue embedding ring plastic yellow 1 cm height form base , tissue embedding cassette metal 3 x 3 point 5 x 1 cm , tissue embedding ring plastic green 1 cm height form base , new methylene blue rtu bottle of 120 ml , wright stain rtu bottle of 500 ml , viral transport media with two swabs , c reactive protein kit for 50 test , pt reagent kit of 25 tests , tissue cassettes and block holders , stainless steel tissue embedding moulds size small pack of 50 and large pack of 50 , uti cytochrome agar pack of 500 gm , hemocue rapid staining of blood smear sigma aldrich

corporations/Associations/Others

CTN :39816385 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

State Government

CTN :39798860 Due date: 28 Mar, 202528 Mar, 2025 10.00 Lacs
Tender For supply of leb regent- anti a,b,d, bilirubin kit erba, blue tips, creatinine erba, deionised water, esr stand plastic, glass slides, esr tube western green plastic, glucose test kit liquid form, preg test device, test tube 3 inch glass (borocil), urine reagent strip l0 para, (bayers), widal test kit (tu-cd), yellow tips, disposible test tubes with cap, (vacutainer type)(/plane va ri ls, plastic with cap), sgot kits liquid form erba, sgpt kits liquid form erba, micropipette 5-50, 0-10, micropipette 1000 micro liter, micropipette 10-1000,0-500 micro, cappilary tube, cover slip, vdrl kit erba, urea kit erba, t-protien kit erba, s, alkaline phos.kit /erba, disposible serum /collecting vails, dispo syringe 2 ml, dispo syringe 5 ml, cotton / rolls 500 gms, filler paper sheet, tissue paper rolls, dispo gloves 6.5" size (exam, gloves, beaker 100 ml (plastic), phynyel l0 ltrs, hyprochloride solution 5 ltrs, micropipette tips yellow, distelled water can 5 ltrs, spirit 5 ltrs, face mask with elastic, dispo aperon 1-, antisptic soap liquid dispentoer, wax paper roll, thermometer big, combo (hlv& vdrl) rapid test kit, a- sd bioline, b- tri dot, c- retero check/other, differematic, blood lancet, jsb stain | 1000m1, jsb stain ll l000ml, microscope slides, gloves 7.5 inch, spirit swap readymade, glocometer, glocometer strips, s. albumin test kit erba, stool test kit, lugol s. lodine, paraffin oil, hb meter digital, tourniquet, cbc tubes (k3 vials) k3 edta vatls, paper roll for cbc machine, capillary glass tubes, sputum/u rine conta i ner, (plastic)with ca, lens cleaning cloths, hand towel, test tube stand platic (a8 tube), s. hdl kit erba, cholestrol kit erba, triglicride (tg) kit erba, hand rub (sanitizer), urine stick alb sug (bayer), micro cuvette 30i. for digital hb, meter, hbsag rapid test card, ldl kit erba, vldl kit erba, dengue card, s. crp kit erba, r.a. factor erba, s. calcium kit erba, s. uric acid reagent erba, s. amylase kit erba, hiv rapid card, malaria rapid test card, esr dispo pipette (plastic), red top cap (vaccutainer type), lest tube dispo, ecg roll, ecg gel, electric hub cutter with needle, burner, hbaic meter, digital bp meter, glucometer, metha nol, urine cover slip, test tube rank (metal), cleaner, mindill (dilunte), lyse bio, minoclair, film lo*tz x-ray film, film 8*1.0 x.ray film

CTN :39799310 Due date: 31 Mar, 202531 Mar, 2025 3.00 Lacs
Tender For rate contract for consumables and reagents (biochemistry dept.)-, glucose kits, , urea kits, , creatinine kits, , total protein kits, , albumin kits, , sulfosalycylic acid, , sodium nitroprusside pure 98%, , acetone, , benedict reagent, , spirit, , d-fructose, , ammonium sulphate, , strong ammonia (25%), , sulpher powder, , car salt, , spirit lamp, , cotton roll, , watman's paper no. 1 and 3, , surgical mask, , gloves, , tips of autopipettes (10ui), , tips of autopipettes (20ui), , droppers (medium size), , test tube holders, , glass test tube (12ml), , test tube (20mi), , conical flask (100 ml), , glass reagent bottle flask (100 ml), , spatula (medium), , glass funnel, , glass petridish (100 ml), , glass stirror, , glass graduated pipette (2mi), , glass graduated pipette (5mi), , test tube cleaning brush (normal), , auto pipettes (2-20 iu), , auto pipettes (100-1000 iu), , colorimeter test tube,

CTN :39776750 Due date: 19 Apr, 202519 Apr, 2025 102
Tender For supllies of lab reagnts and accessories for taluk general hospital karkala - ghk-hcv card, ghk-lamp for biochemistry analyser bs-200 e, ghk-cell cleaner for automated cell counters part sysmax xn 330, ghk- lysercellwdf for automated cell counters part sysmaxxn 330, ghk-sulfolyser for automated 5 part cell counter sysmax xn 330, ghk-cell pack dcl 20lit for 5 part all counter sysmax xn 330, ghk-fully automated biochemistray analayser bs 200e cuvelte segments, ghk-fully automated biochemistray analayser bs 200e mindry probe, ghk-qualicheck norm & path for cst 240 biochemistray analayser, ghk-bath additivse solution for sct 240 biochemistray analayser, ghk-alkaline washing solution cs-t240 biochemistray analayser, ghkk-p.m kit for cst240 biochemistray analayser, ghk-aso test qantitativse method for biochemistray analayser, ghk-ra test qantitativse method for biochemistray analayser, ghk-hepatitis e card, ghk-hepatitis a card, ghk-culture swab, ghk-sodium hypochloride solution, ghk-tourni kit (imported), ghk-capillary tubes 100x1, ghk-microscope slide 50x1, ghk-cover slips, ghk-glucometer strips, ghk-glucometer, ghk-urine container(non sterile), ghk-urine sample container sterile, ghk-plastic test tubes, ghk-bullet vials 500x1, ghk-glass test tubes, ghk-filter paper circle, ghk-tissue paper role, ghk-micro cover slips, ghk-blood lancet 100x1, ghk-microscope bulb, ghk-micro pippers variable 10-50 micro l, ghk-micro pippets fixed 500 micro l, ghk-micro pippets fixed 1000 micro l, ghk-micro tips (yellow) 1000x1, ghk-micro tips (blue) 1000x1, ghk-microscopic slides 50x1, ghk-non vaccum sodium citrate tubes, ghk-non vaccum fluride tubes, ghk-non vaccum plan tubes, ghk-non vaccum edta tubes, ghk-urine strips (10 parameter) per 100, ghk-urine strips(alb & sug) per 100, ghk-esr disposable tubes, ghk-spiritol, ghk-n/10 hcl 500 ml, ghk-3.8% sodium citrate, ghk-glucose-d 75 gms, ghk-widal test kit, ghk-aslo test kit, ghk-ra test kit, ghk-leishman stain, ghk-blood group (abd combo kit ), ghk leptospira(igg & igm), ghk-dengue igg & igm kit, ghk-malaria rapid kit, ghk-urine pragnancy kit, ghk-vdrl kit, ghk-hbsag kit, ghkk-thermal printer paper role, ghk-m-53p probe cleanser(50 ml) , ghk-m-52 lh lyse(100 ml) , ghk-m-52 diff lyse(500ml) , ghk-m- 52d diluent( 20 ltr) , ghk-thermal printer paper role, ghk-hb reagent (cyanmeth method), ghk-hdl cholesterol, ghk-triglycerides, ghk total cholesterol, ghk- uric acid, ghk-creatinine, ghk-urea, ghk-glucose, ghk-ferrtin, ghk-d dimer, ghk-ldh, ghk-crp, ghk-multi control level 2 , ghk-multi control level 1 , ghk-lipid calibrator , ghk-multi sera calibrator , ghk-calcium , ghk-ggt , ghk-alkaline phosphatase (alp) , ghk-sgpt(alt) , ghk-sgot(ast) , ghk-albumin , ghk-total protein , ghk-direct bilirubin , ghk-total bilirubin , ghk-ldl cholesterol , ghk-hdl cholesterol , ghk-triglycerides , ghk-total cholesterol , ghk-uric acid , ghk-creatinine , ghk-urea , ghk-glucose , ghk-g-80 detergent
 Loading, Please wait...

Connect us via What's Up